Maternal imprinting is a process that greatly relies on auditory stimulus. Gottlieb and Miller (1978) discovered that Mallard ducks (Anas platyrhynchos) used their mother's vocalization both preceding and following hatching. They used the maternal calls for species identification as well as to distinguish their mother specifically (Gottlieb and Miller, 1978). Auditory stimulus was not only found to be critical in maternal imprinting, but also in sexual imprinting. Irwin and Price (1999) performed studies about what factors have an affect on sexual imprinting. Through their experiments, they were able to discern that auditory stimulus was a vital constituent of sexual imprinting, or imprinting to find a mate with the ability to reproduce (Irwin and Price, 1999). Since auditory stimulus was such a key factor in both maternal and sexual imprinting, we decided to look into an evolutionary or genetic component. Martin (1975) performed a study to discover whether hormones were coincided with imprinting behaviors in Mallard ducks. He discovered that the ducks had a higher level of adrenal corticosteroids when they were presented with auditory stimulus (Martin, 1975). A specific enzyme that produces the corticosterone is 11-Beta Hydroxysteroid Dehydrogenase Type 1 The enzyme is coded for by the HSD1 gene on chromosome 1 in ducks (Wang et al, 2014). Humans, like ducks, possess the HSD 11B1 gene that codes for the humans' 11-Beta Hydroxysteroid Dehydrogenase Type 1 (Malavasi et al, 2010). The enzyme in humans works in the hypothalamus-pituitary-adrenal response pathway, much like the ducks. We deduced that the enzyme is used for the same reasons in both species. Not only are humans evolutionarily similar to ducks, but they are also similar to chimpanzees. Both humans and chimpanzees are primates and are very similar in genome. Due to that, we decided to use studies performed on chimpanzees as the basis for our human trials. Clark (1993) discovered that vocalizations from different sexes of chimpanzees produced different responses from the opposite sexes. We can infer that because the chimpanzees are attracted to a vocalization of the opposite sex that the humans will be attracted in the same manner because it allows them to find a viable mate.
With all of this information gathered, we wanted to observe attention responses in response to sex specific playback vocalizations in the Mallard ducks and humans. We wanted to know what types of attention responses would be present as well as who would be eliciting the attention responses. We hypothesized that if a sex specific Mallard duck playback vocalization was played over the Bluetooth speaker, then the opposite sex would exhibit attention responses toward the vocalization being played because sexual imprinting is a mechanism that is used by the ducks to associate a call or auditory stimulus to a potential mate, thus the opposite sex. We also hypothesized that if a sex specific human playback vocalization was played over the Bluetooth speaker, then the opposite sex would exhibit attention responses toward the vocalization being played because, evolutionarily, reproduction relies on attraction to the opposite sex. Therefore, the humans should have shown attention responses toward the opposite sex vocalization as well.
Even though the Mallard duck ( Anas platyrhynchos) is the primary subject of the study, it was discovered that the American Black duck (Anas rubripes) is also common to Michigan State University's campus. Due to the fact that both ducks are found on campus, we determined the differences in visual appearances were present between the duck species and their sexes. We thought it was beneficial and necessary to know what the American Black ducks looked like in order to distinguish the Mallard duck from other ducks in the area. Using Birds of Michigan, we were able to differentiate which species and sexes of ducks we were observing (Black and Kennedy, 2003).
It was expected that the ducks would illustrate certain behaviors in response to the playback vocalizations broadcasted over the speaker. Some of the natural behaviors that we observed during preliminary data included pruning and waxing, males fighting over a female, and dabbling in the water for food. Once we started broadcasting the playback vocalizations, we looked for different "attention responses". Attention responses were classified as behavioral responses to the playback where the ducks lift their heads, move toward the speaker, move away from the speaker, ruffle their feathers, or quack. The ducks lifting their heads consisted of them looking around for the source of the sound or staring off into one particular direction. Moving towards the speaker was any movement or approach in the direction of the speaker. Ruffling feathers was more aggressive than the normal behaviors of pruning and waxing, and was observed to be an act of defense of fear. Additionally, quacking was any vocalization made by the ducks. All of the responses observed during preliminary data were noted by us as behaviors to be conscious of during the experimental playback study.
We designed an experiment to focus on the responses of Mallard ducks to playback vocalizations of various species and sexes. We played three different vocalizations. The first tier of vocalizations included the male and female vocalizations of a Mallard duck (Anonymous, 2014).The second tier included the male and female vocalizations of an American Black duck (Anonymous, 2014). Due to the fact that American Black ducks are found around Michigan State University's campus, we decided to employ their call as a positive control. In addition, because American Black ducks and Mallard ducks have been shown to cohabitate and do not competitively exclude one another, we expected Mallard duck responses resulting from American Black duck calls along with American Black duck responses from Mallard duck calls (McAuley et al, 2004).The third tier included no sound being played from the speaker, which acted as a negative control. The no call vocalization ruled out the possibility that the Mallard ducks are attracted to the speaker instead of the duck vocalizations being emitted from the speaker. Through other studies, it was discovered that, to the ducklings, there was a significant preference for the authentic duck calls over the artificial duck calls manufactured by humans for mimicry (Calicutt et al, 2013). Due to this fact, we were able to decide that we wanted to use natural, authentic duck calls for the playback study over a mimicry device, such as a manufactured duck call.
The playback study started on Monday, October 10th, 2016 at 5:00 PM. In order to perform the playback experiment, we completed a form for the Institutional Animal Care and Use Committee, or IACUC, to ensure that we would not harm or disturb the animals in their natural environment. The duck vocalizations were played for seven days a week at 5:00 PM. The vocalizations were played from a bluetooth speaker that is shaped like a snail. The bluetooth speaker was produced by a brand called OnHand. The speaker is called Beyonce the Snail, Shower Speaker, and the manufacturer number is: SBLU-SHSOH. The vocalizations were played via bluetooth through the speaker from our iPhones. The iPhone's volume when playing calls was turned up to the highest volume setting. The bluetooth speaker did not have volume controls, but being able to control the volume from the phone allowed us to control the intensity of the sound and keep it constant. We discovered a research study on the optimal times of activity of Mallard ducks (Korner et al, 2016). Korner (2016), the lead investigator, concluded that the height time for activity of Mallard ducks was around dusk, but we needed to ensure that we could visualize the ducks being observed (Korner et al, 2016). To do so, we chose two times to perform the preliminary observational study: 5:00 PM and 6:00 PM (Haahr, 2016). The researchers went and collected preliminary data. From the data, we concluded that 5:00 PM was more ideal for the experiment because more ducks were present, thus increasing the sample size. The sample size was not large enough with only seven ducks at 6:00 PM, whereas there were upward of seventy total ducks at 5:00 PM. The experiment, therefore, was performed at 5:00 PM. The time is an experimental control. The time remained the same throughout the entire duck-focused portion of the observational study. We also wanted to categorize the days when we play the vocalizations. We referred to "Male Duck Days", we referred to the days where the playback included male Mallard duck vocalizations, a buffer period, a male American Black vocalizations, a buffer period, and no call. When we referred to "Female Duck Days", we referred to the days where the playback included a female Mallard duck vocalizations, a buffer period, a female American Black vocalizations, a buffer period, and no call. To determine whether it was a male or female day, we applied a randomization generator. Through this, it was determined that the days would be alternating between "Male Duck Days" and "Female Duck Days". The observations were accumulated every day for a week. To get the best results, we decided that we would replicate the experiment for a total of three weeks after the initial experimentation week; this summed up to be a total of four observational weeks. We determined the playback vocalization time and the buffer wait time based on a research study performed by Slabbekoorn and Cate (Slabbekoorn and Cate, 1997). Slabbekoorn and Cate emitted their playback vocalizations for one minute and had a two minute wait period between different calls (Slabbekoorn and Cate, 1997). We decided to follow suit since the previous timing was optimal for the other scientists. The selection of the amount of time the duck call was played for was considered a reduce in bias because the random generator was used. The standardization of the amount of time the duck call was played for acted as an experimental control for the experiment. This ensured that the ducks were not were not exhibiting responses to the longevity of the sound being played, but they were exhibiting attention responses to the sound itself. Also, the experiment will be performed in the same location everyday for the length of the observations. The playback study was performed along the Red Cedar River at Michigan State University, on the South side of the river between Wells Hall and the Spartan Stadium, approximately 250 meters from the center of the football stadium.
To record duck behaviors, we created a record keeping sheet that was split up into categories. Along the top of the sheet, there is a section to record the date, time, what sex of the duck vocalization that was being played, and which researchers were present on that day. The chart on the bottom includes included categories for temperature, weather, human interaction, and other animals. The temperature and weather categories are to reduced bias throughout the experiment. To do so this, we recorded the temperature and weather to see if that has it had any influence on the responsive behaviors of the Mallard ducks. The human interaction is was another variable that we cannot could not control. To account for variability, we recorded how many humans are were interacting with the ducks, in what way they are were interacting with the ducks, and how far away they are were in relation to the playback study. The 'other animals' category was included in case the playback study attracts attracted other waterfowl, birds, squirrels, or any other animals from around campus. We tallied the counts of male and female Mallard ducks that exhibited attention responses to each playback vocalization. The columns were labeled by which vocalization was being played. The rows were labeled by which species of duck responded to the playback vocalization. We focused solely on Mallard ducks; however, it is known that the American Black duck were present at the research site. To account for this, we recorded the presence of the American Black ducks, both male and female. In addition to tallying, we wrote down specific behaviors that we observed, and tallied the specific behaviors. To record visual observations, we used our iPhones to record videos of the research that day. The recorded videos allowed us to go back through and recount and verify our data as well as use the video for clips for the documentary.
Once all data collection was completed, we analyzed and quantified our data. The data collected was all counts and tallies with qualitative descriptions. To quantify the data, we compared the amount of male or female Mallard ducks responding that responded with a certain attention response to the total amount of male or female Mallard ducks by using a percentage. Using percentages allowed us to see a comparison of how many ducks were responding out of the whole amount. Also, this allowed a consistent measure of responsiveness in the Mallard ducks throughout the experiment when the sample size varied from day to day. We cannot control the amount of ducks that were present on a given day, therefore, this percentage procedure allowed us to account for the ever-changing sample size of ducks present at the Red Cedar River. We performed a series of statistical tests to determine if the data concluded was statistically significant. ANOVA tests, in which varying data of our study was divided into groups, was used because of the range of different attention responses elicited. Two ANOVA tests were used for male duck vocalizations, one across populations of male Mallards and another across populations of male American Black ducks. Two more ANOVA tests were used for female duck vocalizations, one across the population for female Mallards and another across populations of female American Black ducks. Two more ANOVA tests were used between human responses and duck responses, one for different attention responses of ducks and another for the different attention responses of humans. A t-test was used for both male and female human data because we had such small samples and were only looking at two populations. One test was used across the population for male humans, and another used for the population of female humans. We used this data to insert error bars using the standard deviation calculated for each population. This will be inserted around the mean for each population.
After the observational study, we moved on to test the genetic aspect of the Mallard ducks. During the last few days of the playback study, we collected feathers that came off of the Mallard ducks as they were pruning themselves. Altogether, we managed to collect a total of seven feathers and preserve them in the freezer of our lab. In order to extract the DNA from the feathers, we had to purchase and follow the instructions from the manufacturer of a DNeasy kit made by QIAGEN, Inc. (Harvey et al, 2005). Once the DNA is extracted we had to purify it. We used the same primers that Wang and colleagues (2014) used for the HSD1 gene. The forward primer had the following base sequence: CTTTGGGGCAGGCAACAGC (Wang et al, 2014). The reverse primer had the following base sequence: ATGCGTAGCAGCGTGAAGCC (Wang et al, 2014). We then performed PCR to amplify the gene with the primers used in a previous study. After creating a 1% agarose gel, we input the PCR solution into the different wells of the gel and ran it through with proper dyes. After running the gel, it was placed under a UV light to see the length of the different base pairs.
Human ( Homo sapiens) Playback Experiment
After conducting the organismal aspect of the experiment on Mallard ducks (Anas platyrhynchos), we wanted to find a homologous behavior exhibited by humans( Homo Sapiens). We observed both male and female subjects during the playback experiment. During the playback experiment, there were certain attention responses that were expected but not limited to which were: ignoring the speaker, looking at the speaker when passing it, and being confrontational or inquisitive about the playback vocalization. When it came to ignoring the speaker, we believed that included people with headphones in, people that are were in conversation, and people who are were not making eye contact with where the noise was coming from. The second behavior that was mentioned was looking at the speaker while passing it. We defined this behavior as the human turning his or her head in the direction of the playback vocalization in the one meter that precedes the speaker location. The third behavior was becoming confrontational or inquisitive about the playback vocalization. We defined this behavior as the humans questioning the sound, moving the speaker, or becoming increasingly agitated over the playback vocalizations.The behavior of ignoring was more of a natural response. During the no call vocalization, we observed how the humans were behaving as they walked by when no sound was played. We expected to see people ignoring the vocalization with their headphones in their ears, people deep in conversation with their peers, people who were on their bikes or skateboards, and people who walk without glancing toward the speaker with no vocalizations. All of the results were noted during the observations of the humans.
During the human portion of the playback experiment, there were two categories of vocalizations that we utilized. The first category was classified as "Male Human Days". These days consisted of a male vocalization, buffer period, and a no call period. The second category was classified as "Female Human Days". These days consisted of a female vocalization, buffer period, and no call period. The male human vocalization was a male human talking about Michigan State University tennis; this topic was randomly selected through the randomization generator (Haahr, 2016; Anonymous, 2016 ). The female human vocalization was a female human talking about Michigan State University tennis; this topic was randomly selected through a the randomization generator as well (Haahr, 2016; Anonymous, 2015). All playbacks were played for one minute and followed by a two minute buffer period. We chose these times based on a research study performed by Slabbekoorn and Cate (1997). These researchers performed a playback study on doves and used the one minute playback and two minute buffer period; these times worked for the other researchers which is why we decided on these times (Slabbekoorn and Cate, 1997). This is important because this allowed us to use the amount of time the playback was played as a control to make sure that it is was not the longevity of the playback that was attracting them; it is was the actual playback that was causing a response. Throughout the experiment, we kept the location and time constant, to control for bias. The experiment took place along the Red Cedar River approximately 250 meters from the football field. Also, the time remained constant throughout the experiment. The location remained at the randomly selected time for the longevity of the experiment.
The playback experiment started on Monday, October 24th, 2016 at 4:00 PM. During preliminary data collection, no humans were walking on the weekends. Because of this, we thought data would be skewed and the weekends would be disregarded, so weekends were not included for data collection of the human aspect of the observational experiment and it was decided data collection would start on a Monday. We used a random generator to choose a time, which ended up being 4:00 PM (Haahr, 2016). The experiment included playback vocalization broadcasted from a bluetooth speaker from Monday to Friday, and the categories of the sounds was also chosen at random by a random generator (Haahr, 2016). All playback vocalizations were played over the bluetooth speaker via iPhones, we set the volume on the iPhone as well as the sound on the bluetooth speaker to the highest setting. The bluetooth speaker that was used was by the brand OnHand. It is called "Beyonce the Snail" Shower Speaker, and its manufacturer number is was: SBLU-SHSOH. We played alternating days of "Female Human Days" and "Male Human Days" for five days during the week. This was replicated for a second week of experimentation.
During the playback study, there are various methods we employed to record data. We used our iPhones to record all visual observations. We used the video data to compare the counts of data for the day to the video to ensure that their all data was accurate. The other method of collecting data was the data recording sheet. The data sheet had a chart across the top, where we recorded the date, which researchers were observing that day, the time, and whether it was "Male Human Day" or "Female Human Day". The table in the middle was essential for this observational study. We used tallies to count how many males responded to a call and how many females responded to a call. The final box along the bottom had four different sections: temperature, weather, male behaviors, and female behaviors. Temperature and weather were both natural forces that we cannot could not control. Due to that this, we decided to keep track of them. If they cannot control it, they decided to keep track of it and to see discover if there was a trend in the responses in correlation to temperature and weather. Also, male behavior and female behavior sections were for qualitative notes where we could add extra notes about the different attention responses exhibited in reaction to the playback vocalizations.
Once all of the data collection was complete, we analyzed the ten days of data collected. In total, there was five days of day of playback calls per sex. To quantify the data, we took the original counts of humans and calculate calculated them into percentages of how many females responded out of females present, and how many males responded out of males present. This eliminated the errors changing sample sizes. We could not control how many humans would walk by everyday. Due to this, we quantified our data into percentages to bypass the variable sample size. We decided to perform numerous statistical tests with our data to determine if any of the data we collected was statistically significant. A t-test was used for both male and female human data because we had such small samples and were only looking at two populations. One test was used across the population for male humans, and another used for the population of female humans. Another t-test was used to perform a test on the statistical significance of the two different attention responses observed from the humans. We used this dat to insert error bars using the standard deviation calculated for each population. This will be inserted around the mean for each population.
After the observational study, we moved on to test the genetic aspect of the humans. We obtained IB3 sample cells from another lab. We used the same primers that Wang and colleagues (2014) used for the HSD1 gene. The forward primer had the following base sequence: CTTTGGGGCAGGCAACAGC (Wang et al, 2014). The reverse primer had the following base sequence: ATGCGTAGCAGCGTGAAGCC (Wang et al, 2014). Wang and colleagues (2014) performed their experiment on broiler chickens; however, we used their primers in the hopes of discovering that both Mallard ducks and humans have the same genome to anneal to the same primers. We then performed PCR to amplify the gene with the primers used in a previous study. After creating a 1% agarose gel, we input the PCR solution into the different wells of the gel and ran it through with proper dyes. After running the gel, it was placed under a UV light to see the length of the different base pairs.
Results
Written and Revised by: A51800088
Mallard Duck ( Anas platyrhynchos) Playback Results
Over the course of duck experimentation, there was 28 days of data. Throughout the four weeks of playback observations, both Mallard ducks (Anas platyrhynchos) and American Black ducks (Anas rubripes) were present for most days. After tallying the data, all of the raw data sets were converted to percentages compared to the total duck within that sex and species specific population. For each individual day, the total amount of responses were totaled. Then the total number of sex and species specific ducks were totaled. For example, the total amount of attention responses exhibited by male Mallard ducks was divided by the total number of male Mallard ducks present during the experimentation period for that day. Once the percentages were calculated for each day, all of them were added together and divided by the total number of days in the data set to calculate the average percentage of responses of the ducks.
One of the vocalizations we used was a male Mallard duck vocalization to see how many attention responses would be exhibited by the ducks in response to the playback call (Figure 1C). When the male Mallard duck vocalizations were played over the bluetooth speaker, male Mallard ducks responded 29.1% of the time. Female Mallard ducks responded 25% of the time, over the length of the experiment. Male American Black ducks responded 5% of the time. Female American Black ducks responded 20% of the time. For this portion of the study, we had four different populations. To run a statistical test on this information, we performed an ANOVA test across the Mallard ducks and American Black ducks of both sexes when male Mallard duck playback vocalizations were played. For male Mallard ducks, there was a standard deviation of SD=18.4879 around the average percentage. For female Mallard ducks, there was a standard deviation of SD=12.8927 around the average percentage. For male American Black ducks, there was a standard deviation of SD=7.9057 around the average percentage. For female American Black ducks, there was a standard deviation of SD=21.08185 around the average percentage. From the ANOVA test, we also discovered that the p-value was p=0.3658. Due to the fact that the p-value was higher than 0.05, the data for average percentages of attention responses when the male Mallard duck vocalizations were played was not statistically significant.
The male American Black duck vocalizations were another playback call used to test the attention responses of the ducks along the Red Cedar River (Figure 1D). When the male American Black duck vocalizations were played over the bluetooth speaker, male Mallard ducks responded 65.1% of the time. Female Mallard ducks responded 59.6% of the time, over the length of the experiment. Male American Black ducks responded 23.3% of the time. Female American Black ducks responded 15% of the time. For this portion of the study, we had four different populations. To run a statistical test on this information, we performed an ANOVA test across the Mallard ducks and American Black ducks of both sexes when male American Black duck playback vocalizations were played. For male Mallard ducks, there was a standard deviation of SD=16.4189 around the average percentage. For female Mallard ducks, there was a standard deviation of SD=16.57845 around the average percentage. For male American Black ducks, there was a standard deviation of SD=20.8567 around the average percentage. For female American Black ducks, there was a standard deviation of SD=16.8737 around the average percentage. From the ANOVA test, we also discovered that the p-value was p=0.0051. Due to the fact that the p-value was lower than 0.05, the data for average percentages of attention responses when the male American Black duck vocalizations were played was somewhat statistically significant.
Another vocalization we used was the female Mallard vocalization to see how the attention responses of ducks would compare with the other vocalizations (Figure 2D). When the female Mallard duck vocalizations were played over the bluetooth speaker, male Mallard ducks responded 50.3% of the time. Female Mallard ducks responded 47.1% of the time, over the length of the experiment. Male American Black ducks responded 39.3% of the time. Female American Black ducks responded 11.1% of the time. For this portion of the study, we had four different populations. To run a statistical test on this information, we performed an ANOVA test across the Mallard ducks and American Black ducks of both sexes when female Mallard duck playback vocalizations were played. For male Mallard ducks, there was a standard deviation of SD=13.13155 around the average percentage. For female Mallard ducks, there was a standard deviation of SD=13.5933 around the average percentage. For male American Black ducks, there was a standard deviation of SD=23.6326 around the average percentage. For female American Black ducks, there was a standard deviation of SD=16.66665 around the average percentage. From the ANOVA test, we also discovered that the p-value was p=0.0861. Due to the fact that the p-value was higher than 0.05, the data for average percentages of attention responses when the female Mallard duck vocalizations were played was not statistically significant.
The last playback vocalization we used for the duck study was the female American Black duck to see how this call would affect the exhibited attention responses (Figure 2E). When the female American Black duck vocalizations were played over the bluetooth speaker, male Mallard ducks responded 56% of the time. Female Mallard ducks responded 54.9% of the time, over the length of the experiment. Male American Black ducks responded 45.7% of the time. Female American Black ducks responded 18.6% of the time. For this portion of the study, we had four different populations. To run a statistical test on this information, we performed an ANOVA test across the Mallard ducks and American Black ducks of both sexes when female American Black duck playback vocalizations were played. For male Mallard ducks, there was a standard deviation of SD=19.8037 around the average percentage. For female Mallard ducks, there was a standard deviation of SD=22.0191 around the average percentage. For male American Black ducks, there was a standard deviation of SD=23.6326 around the average percentage. For female American Black ducks, there was a standard deviation of SD=18.8665 around the average percentage. From the ANOVA test, we also discovered that the p-value was p=0.2256. Due to the fact that the p-value was higher than 0.05, the data for average percentages of attention responses when the female American Black duck vocalizations were played was not statistically significant.
Human (Homo sapiens) Playback Results
The human (Homo sapiens) experiment lasted for ten days of data. Throughout the two weeks of playback experiment, we observed both male and female humans exhibiting attention responses toward the playback vocalizations. After tallying the data, all of the raw data sets were converted to percentages compared to the total human counts of the specific sex. For each individual day, the total amount of responses were totaled. Then the total number of sex specific humans were totaled. For example, the total amount of attention responses exhibited by male humans was divided by the total number of male humans present during the experimentation period for that day. Once the percentages were calculated for each day, all of them were added together and divided by the total number of days in the data set to calculate the average percentage of responses of the ducks.
One of the vocalizations we used was a male human vocalization to see how many attention responses would be exhibited by the humans, both male and female, in response to the playback call (Figure 3B). When the male human vocalizations were played over the bluetooth speaker, male humans responded 17% of the time. Female humans responded 33% of the time, over the length of the experiment. For this portion of the study, we had two different populations: male and female humans. To run a statistical test on this information, we performed a t-test across the male and female humans when the male human vocalizations were being broadcasted. For male humans, there was a standard deviation of SD=17.01 around the average percentage. For female humans, there was a standard deviation of SD=26.18 around the average percentage. From the t-test, we also discovered that the p-value was p=0.3471 Due to the fact that the p-value was higher than 0.05, the data for average percentages of attention responses when the male human vocalizations were played was not statistically significant.
Another vocalization we used was a female human vocalization to observe how many attention responses would be exhibited by the male and female humans (Figure 3C). When the female human vocalizations were played over the bluetooth speaker, male humans responded 27.6% of the time. Female humans responded 9.2% of the time, over the length of the experiment. For this portion of the study, we had two different populations: male and female humans. To run a statistical test on this information, we performed a t-test across the male and female humans when the female human vocalizations were being broadcasted. For male humans, there was a standard deviation of SD=10.81 around the average percentage. For female humans, there was a standard deviation of SD=14.45 around the average percentage. From the t-test, we also discovered that the p-value was p=0.0805. Due to the fact that the p-value was higher than 0.05, the data for average percentages of attention responses when the female human vocalizations were played was not statistically significant.
References
Written and Revised by: A51733235
Alan, R., A. Balic, C.M. Bishop, J. Blas, M. Bohannon, W. Bottjet. Yoshimura. 2015.
Sturkie's Avian Physiology: Sixth Edition. Elsevier Inc. Oxford, UK.
Anonymous. 2012. Xeno-Canto. http://www.xeno-canto.org, Last Accessed 10/01/16.
Anonymous. 2016. Spartans close out regular season with 4-3 victory over Hawkeyes.
https://www.youtube.com/watch?v=B0oAbxQFlMM, Last Accessed 10/17/16.
Black, T. and G. Kennedy. 2003. Birds of Michigan. Lone Pine Publishing International
Inc, Canada.
Boyd, H. and E. Fabricius. 1965. Observations on the Incidence of following of Visual and
Auditory Stimuli in Naive Mallard Ducklings (Anas platyrhynchos). Behavior 25: 1-15.
Callicutt, J.T., R.M. Kaminski, R. Shmulsky, M.L. Schummer, and J.P. Lestrade. 2013.
Acoustical Comparison between Decrescendo Calls of Female Mallards and Mimicry by Humans Using Artificial Duck Calls. Wildlife Society Bulletin 37(1): 101-106.
Crockford,C.,R.M. Wittig, and K. Zuberbuhler. 2014.
An Intentional Vocalization Draws Other's Attention: A Playback Experiment with Wild Chimpanzees. Animal Cognition 18: 581-591.
Gottlieb, G., and D. Miller. 1978. Maternal vocalizations of Mallard Ducks (Anas platyrhynchos).
Animal Behavior 26: 1178-1180.
Haahr, M. 2016. True Random Number Service. https://www.random.org, Last Accessed 10/01/2016.
Harvey, M.G., D.N. Bonter, L.M. Stenzler, and I.J. Lovette. 2005. A comparison of plucked feathers versus blood samples as DNA sources for molecular sexing. J. Field Ornithology 77(2): 136-140.
Irwin, D.E., and T. Price. 1999. Sexual Imprinting, learning and speciation. Heredity 82(4): 347-354.
Korner, P., A. Sauter, W. Fiedler, and L. Jenni. 2016. Variable allocation of activity to daylight
and night in the Mallard. Animal Behaviour 115: 69-79.
Malavasi, E.L.V., V. Kelly, N. Nath, A. Gambineri, R.S. Dakin, U. Pagotto, R. Pasquali, B.R.
Walker, and K.E. Chapman. 2010. Functional Effects of Polymorphisms in the Human
Gene Encoding 11 Beta-Hydroxysteroid Dehydrogenase Type 1( 11 Beta-HSD1): A
Sequence Variant at the Translation Start of 11 Beta- HSD1 Alters Enzyme Levels.
Journal of Endocrinology 151(1): 195-202.
Martin, J.T. 1975. Hormonal Influences in the Evolution and Ontogeny of Imprinting Behavior
in the Duck. Progress in Brain Research 42: 357-366.
McAuley, D.G., D.A. Clugston, and J.R. Longcore. 2004. Dynamic use of wetlands by black
ducks and mallards: evidence against competitive exclusion. Wildlife Society Bulletin
32(2): 465-473.
Newman, R. (1998). A Bug's Life Suite (Recorded by Randy Newman). A Bug's Life
:An Original Walt Disney Records Soundtrack ( iTunes). Walt Disney Records/Pixar.
Ricketts, M.L., K.J. Shoesmith, M. Hewison, A. Strain, M.C. Eggo, and P.M. Stewart. 1998.
Regulation of 11 beta-hydroxysteroid dehydrogenase type 1 in primary cultures of rat and
human hepatocytes. Journal of Endocrinology 156: 159-168.
Slabbekoorn, H., and C.T. Cate. 1997.
Stronger Territorial Responses to Frequency Modulated Coos in Collard Doves. Animal Behaviour 54(4): 955-965.
Wang, S., Y. Ni, F. Guo, Z. Sun, A. Ahmed, and R. Zhao. 2014. Differential expression of
hypothalamic fear- and stress- related genes in broiler chickens showing short or long
tonic immobility. Domestic Animal Endocrinology 47: 65-72.
Figures
Written By: A50815563
Figure 1- Average Percent of Ducks Responding to Male Duck Vocalizations. Every other day, we would play male vocalizations of both Mallard and American Black ducks. When we did so, we recorded how many ducks of each sex and species responded. The male Mallard duck responses are shown in green. Female Mallard responses are shown in red. Male American Black duck responses are shown in blue. Female American Black duck responses are shown in purple. A. One of the attention responses accounted for, swimming toward the playback vocalization, is shown. The ducks here are swimming toward the vocalization. B. Another attention response that was accounted for was looking around for the playback vocalization. In this picture, multiple ducks were looking around at once for the source of the playback vocalization. C. When male Mallard duck vocalizations were used as the playback call, male Mallard ducks responded 29.1% of the time, averaged over the length of the experiment. Female Mallard ducks responded 25% of the time. Male American Black ducks responded 5% of the time. Female American Black ducks responded 20% of the time. When an ANOVA statistical test was run for a four sample independent data set, the P-value of the data was P=0.3658. Due to the fact that the P-value is above 0.05, the average percent of attention responses exhibited by the ducks in the presence of a male Mallard duck vocalization is not significant. D. When male American Black duck vocalizations were used as the playback call, male Mallard ducks responded 65.1% of the time, averaged over the length of the experiment. Female Mallard ducks responded 59.6% of the time. Male American Black ducks responded 23.3% of the time. Female American Black ducks responded 15% of the time. When an ANOVA statistical test was run for a four sample independent data set, the P-value of the data was P=0.0051. Due to the fact that the P-value is lower 0.05, the average percent of attention responses exhibited by the ducks in the presence of a male American Black duck vocalization is somewhat significant.
Written By: A50815563
Figure 2- Average Percent of Ducks Responding to Female Duck Vocalizations. Every other day, we would play female vocalizations of both Mallard and American Black ducks. When we did so, we recorded how many ducks of each sex and species responded. The male Mallard duck responses are shown in green. Female Mallard responses are shown in red. Male American Black duck responses are shown in blue. Female American Black duck responses are shown in purple. A. One of the attention responses accounted for, swimming away from the playback vocalization, is shown. The ducks here are swimming away from the vocalization. B. Another attention response that was accounted for was erecting their wing feathers in response to the playback vocalization. In this picture, a male mallard flapped his wings in response to the speaker. C. Another attention response that was recorded was quacking. In this picture, multiple ducks are seen quacking in response to the playback vocalization. D. When female Mallard duck vocalizations were used as the playback call, male Mallard ducks responded 50.3% of the time, averaged over the length of the experiment. Female Mallard ducks responded 47.1% of the time. Male American Black ducks responded 39.3% of the time. Female American Black ducks responded 11.1% of the time. When an ANOVA statistical test was run for a four sample independent data set, the P-value of the data was P=0.0861. Due to the fact that the P-value is above 0.05, the average percent of attention responses exhibited by the ducks in the presence of a female Mallard duck vocalization is not significant. E. When female American Black duck vocalizations were used as the playback call, male Mallard ducks responded 56% of the time, averaged over the length of the experiment. Female Mallard ducks responded 54.9% of the time. Male American Black ducks responded 45.7% of the time. Female American Black ducks responded 18.6% of the time. When an ANOVA statistical test was run for a four sample independent data set, the P-value of the data was P=0.2256. Due to the fact that the P-value is above 0.05, the average percent of attention responses exhibited by the ducks in the presence of a female American Black duck vocalization is not significant.
Written By: A50815563
Figure 3- Average Percent of Humans Responding to Sex Specific Vocalizations. Every week day, we would play alternating male and female vocalizations of humans. During the experimentation period, we would record how many humans would respond in each sex. Male human response is recorded in blue. Female human response is recorded in pink. A. One of the main attention responses recorded for the humans was looking toward the playback vocalization. In the picture, two walkers are shown glancing toward the speaker. Their faces are blurred for privacy purposes. The other attention response, which is not pictured, is when the humans became confrontational. We only observed this once, however, it involved the subject confronting us about our research and trying to take the Bluetooth speaker. B. When male humans talking about Michigan State tennis were played, male humans responded 17% of the time, averaged over the length of time the experiment was performed. Female humans responded 33% of the time, averaged over the length of the time the experiment was performed. When a t-test statistical test for two independent samples was performed, the two tailed P-value was P=0.3471. Due to the fact that the P-value is above 0.05, the average percent of attention responses exhibited by the humans in the presence of a male human vocalization is not significant. C. When female humans talking about Michigan State Tennis were played, male humans responded 27.6% of the time averaged over the length of the experiment. Female humans responded 9.2% of the time, averaged over the length of the experiment. When a t-test statistical test for two independent samples was performed, the two tailed P-value was P=0.0805. Due to the fact that the P-value is above 0.05, the average percent of attention responses exhibited by the humans in the presence of a female human vocalization is not significant.
Written By: A50815563
Figure 4- Total Percent of Exhibited Attention Responses in Comparison to Total Responses in Mallard Ducks and Humans. A. In total, there were 5 total attention responses recorded for the ducks throughout experimentation: quacking, swimming toward the playback, swimming away from the playback, looking for the sound, and erecting their feathers. All of the responses were totaled and percentages were calculated as to what percentage of the time were certain attention responses elicited. Certain ducks elicited more than one behavior, therefore the total of all of the responses added together may not equal 100%. Quacking was exhibited 7.023% of the time. Swimming toward the playback vocalization happened 26.254% of the time. Swimming away from the playback vocalization happen 36.957% of the time. Erecting feathers happened 0.167% of the time. Looking for the sound happened 29.599% of the time. When an ANOVA statistical test was run for a five sample independent data set, the P-value of the data was P=0.017. Due to the fact that the P-value was below 0.05, the percentage of specific attention responses in comparison to total responses in ducks was somewhat significant. A Tukey test was run; however, no significance was found between any two species. B. In total, there were 2 total attention responses recorded for the humans throughout experimentation: looking for the playback vocalization and becoming confrontational. Looking for the playback vocalization happened 93.75% of the time. Becoming confrontational happened 6.25% of the time. When a t-test statistical test for two independent samples was performed, the two tailed P-value was P=0.3994. Due to the fact that the P-value is above 0.05, the percentage of specific attention responses in comparison to total responses in humans was not significant.
Written By: A50815563
Figure 5- Homologous Communication of Human and Mallard Ducks: Increased Attention Responses to Sex Specific Playback Calls. Through this documentary, we displayed the purpose, hypothesis, methods, and results of both of aspects of our experiments: Mallard duck and humans. We also explained the progress of our genetic testing. We explained how we collected and preserved feathers and how we had access to IB3 human cells. We demonstrated all of our results through figures laid on top of our video. Also, we explained the significance of our project in science.
