The ability for animals to distinguish between safe and dangerous situations is imperative for their well-being (Boissy, 1995). As defined by Thierry Steimer in her journal article The Biology of Fear and Anxiety-Related Behaviors, fear is an emotional state instigated by a potentially hostile action that could impact the survival capability of an animal (Steimer, 2002). Once a stress signal is received from a potential threat, a fight or flight state is triggered in the animal. The fight or flight reflex is defined as the involuntary physiological reaction that occurs when an animal encounters a potentially life threatening situation. Mallard ducks have been observed to use both fight and flight behaviors in their lifetime. The fight response is most commonly utilized when the ducks are trying to protect their ducklings or eggs. Mallard ducks use the flight response more commonly when their main priority is only to protect themselves. These tendencies in mallard ducks were observed by Elston Dzus and Robert Clark in their experimental study exploring ducklings survival in different brood sizes (Dzus & Clark, 2016).

When faced with fear, animals have been known to react by displaying specific identifiable behaviors that can be studied through visual and auditory observation. In humans, it has been found that the fastest way to distinguish the emotion of fear is through facial expression, while other body language is quick to follow (Heijnsbergen et al., 2007). From this study, humans can be identified as experiencing fear through visual cues they produce. Similarly, mallard ducks have body language to indicate when they are frightened by their surroundings that can be observed and interpreted. These behaviors tend to be specific to the type of threat being encountered. As seen in a study conducted with mallard ducklings, if a duck detects an aerial predator, it most frequently swims to deeper water if possible to escape the threat by diving (Dessborn et al, 2012). Because it has been seen that ducks react differently in response to various stimuli, it may suggest that there could be a key difference in how mallard ducks react to different types of fear. It is important to establish the unique signals within each species in order to better understand the observations made in the experiment (Relyea & Werner, 1999). By monitoring these behaviors, it is possible to make conclusions about the influence of the environment on both humans and mallard ducks. The focus will be on the difference in innate and learned fear responses in each species. Simply explained, innate responses are those that an organism naturally displays from birth in response to a stimuli. Learned behaviors are obtained by interaction with their surrounding environment and organisms, not naturally present at birth (Upen, 2019). By exposing organisms to innate and learned stimuli, different reactions may be assumed to be expected.

In a study conducted at the Massachusetts Institute of Technology, baby mallard ducks were tested for having habitual survival instincts against a cardboard cutout of a hawk, their natural predator (Melzach, 1959). As a result of the study, it was observed that the emotional and habitual fear that ducks had of cardboard cutout of the hawk gradually decreased over time, but they still responded in a non-emotional way. This suggests that over time, the mallard ducks responded in a more thought out way, and could be a sign of a chemical change in the central nervous system (Melzach, 1959). Another conclusion that can be drawn from Melzach ' s study is that the habitual fight or flight response in mallard ducks has decreased over time due to being exposed to the continual visualization of the cardboard predator. Similarly to this study, an imitation of a hawk will be performed in front of the mallard duck, however, this will be done through the use of a playback sound of a hawk to elicit a learned fear response from the mallard duck. Actual predators are not the only ones that can have an influence on animals in their habitats. Even when a predator is not present, an organism may respond to an auditory or visual stressor that is not a real threat, but the organism still responds as though it is in the interest of self-preservation. In a study done in northern Weld County, Colorado, observers went into farms and other grasslands to test the disturbance of humans on different types of birds of prey (Holmes et al, 1993). It was found that different types of birds observed were less likely to be flushed out by a vehicle approaching than by pedestrians on foot (Holmes et al, 1993). The results from this study can also be seen as the natural flight response in different types of birds, as humans invade these animal ' s natural habitat. Similar to this study, tests will focus on how the mallard duck responds when an innate sudden movement is made towards it in its natural habitat and then comparing it to a similar human test.

When taking into account the studies spoken about earlier, it is hypothesized that the mallard ducks and humans will respond similarly to the different fight or flight triggers. In analyzing both species ' s learned responses, it is predicted that when presented with a sound resembling danger, both organisms will show flight reactions by running away from the danger and audibly signal to others that there is danger present (Sargeant & Eberhardt, 1975). In testing the innate responses of multiple subjects in both species, it is predicted that both the ducks and humans will assume the flight reaction again when exposed to an innate fear trigger (Rupia & Binning et al, 2016). However, after a flight response is acted out instinctively, a fight reaction is expected to follow from the human subjects due to the presence of NRSF, a silencer of the ADRA2C gene. Because of this, the NRSF reduces the effects of the ADRA2C gene, allowing the sympathetic nervous system to function as it originally did, enabling a more severe fight or flight response to the stimuli from humans. For example, when simulating a sudden movement, both species are expected to attempt to flee from the trigger because of their sudden fear for their safety due to their innate fear response. Humans, being a more complex species, may speak aggressively and run at the aggressor in a fight reaction after the flight response. This differentiation in fight responses is predicted to be a result of the unequal processing of the ADRA2C gene in the two species. The ADRA2C gene is found on chromosome 4 in both mallards and humans. Because of how humans evolved, the species developed a repressor on the area responsible for encoding the ADRA2C gene on their synaptic nerve causing a lessening in the regulation of the fight or flight response (Lee & Choi et al, 2018). The overall purpose is to verify if the ADRA2C gene is expressed similarly across the two different species and if the suppressor would influence its expression. The ADRA2C gene is proposed to be responsible for the expected similar initial fight or flight responses to innate and learned stimuli in both mallards and humans, with slight differences in post reaction responses due to the NRSF silencer in humans.

The observational study of the fear response in mallard ducks (Anas platyrhynchos) in the Red Cedar river at Michigan State University was conducted on various days at different times throughout the first semester to ensure randomization. Unexpected sudden movement stressors were presented to elicit a natural fear-based response of the mallard duck. After presented with stimuli, researchers observed for two minutes to ensure the full response was noted and a period of at least ten minutes separated each trial (Dessborn et al, 2012). To record the responses, researchers filmed with a smartphone camera, as well as articulating the responses through handwritten notes. For the control for this test, a researcher sat on a rock by the mallards, without making any sounds or movements. A researcher then sat on a rock near the mallards, but then the created sudden movements in an attempt to resemble an innate fear response from the mallard ducks. The reason a sudden movement was chosen as the natural fear is because animals are known to react instinctively to loud, unexpected movements or sounds in an attempt to protect themselves (Lang, 2006). The data collected of the fear response of the duck was graded on a scale of 0 to 3 (0-no reaction, 1-some reaction/head turn, 2-cautiously looking around/auditory response, 3-completely afraid and left the area). This scale was derived from J.L. Lanier’s scale used to rank responses of cattle to simulated stimuli that were present in a rodeo (Lanier et al, 2000). After categorizing the data on the scale, we analyzed it by comparing the mean responses of the organisms using the one-way ANOVA test to see if the two species reactions were statistically different.

The natural fear-based test was then reproduced in the context of human (Homo sapien) fear. The specific reactions were recorded to enable a more in depth analysis of what exactly those behaviors entailed, and commonalities among the behaviors were noted. The location of the observations was beside the bike path behind the Eli Broad College of Business building at Michigan State University because of the high volume of people that cycle through the location, which could maximize the sample size. The test was performed on different days and times throughout the semester to ensure randomization. To accurately compare the known behaviors of humans and mallards, similar tactics to those used in the mallard’s innate fear test previously explained were implemented to gather information about human responses. A researcher walked down the bike path, without making any noise or sudden movements, as people walked by to use as a control to compare against the test trials. The test, similar to the mallards innate fear test, was done by walking up behind a person and creating sudden movements, to ensure the subject did not expect the stimuli. This action was chosen because an unanticipated sudden movement tends to trigger a response naturally (Lang, 2006). Again, video and audio were recorded with a smartphone, so that the conclusions made were not subjective and also allowed the researchers to look back at the recording if something was missed (Mcgregor, 2000). Handwritten notes were taken again as well. The researchers focused on the behaviors in response to the stimuli described, such as orientation toward perceived threat, startle responses, signs of aggression, and flinches, while also noting a lack of reaction. These behaviors were determined based on J.L. Lanier’s research on cattle reactions when exposed to sudden stimuli involved in rodeos where they recorded behaviors on a scale in response to various visual and auditory stimuli (Lanier et al, 2000). The same scale used for the mallards will be implemented in the analysis of the human reactions, with different human specific behaviors. (0-no response, 1-head turn, 2-cautiously looking around/vocal response, 3-actively trying to avoid/find source). After categorizing the data on the scale, we analyzed it by comparing the mean responses of the organisms using the one-way ANOVA test to see if the two species reactions were statistically different.

Playback vocalizations of a red-tailed hawk were broadcasted over a MEGABOOM bluetooth speaker along the Red Cedar river. The red-tailed hawk was chosen as the testing variable because red- tailed hawks are known predators of mallard ducks and live in Michigan (“Raptors”, 2007). The red-tailed hawk vocalization was obtained from the youtube video Red-Tailed Hawk Sound, Call, and Screech posted by the author Birds Inc. The MEGABOOM speaker was placed at the edge of the river and the observer recorded data approximately two meters away from the shore line to ensure the observer was not causing the reaction (Loughry & McDonough, 1988). Playback sounds were played for 30 seconds with a two minute pause between each trial (Dessborn et al, 2012). If no fear response was displayed, trials were observed for a minimum of three minutes to ensure the mallard did not have a delayed response (Loughry & McDonough, 1988). If the duck responded, scientists waited five minutes after the response to record behaviors displayed to be certain all fear responses were recorded (Fichtel, 2007). The control variable for this experiment was the playback of a chickadee vocalization. The chickadee was chosen for the control because it is known to frequent the Michigan State University campus and is not a predator of the mallard duck. The chickadee playback is a negative control because no response is expected. Additionally, video and audio were recorded with a smartphone, so that the conclusions made were not subjective and also allowed the researchers to look back at the recording if something was missed (Mcgregor, 2000). Handwritten notes were taken as well.The reaction of the duck was observed and graded on a scale of 0 to 3 (0-no reaction, 1-some reaction,2-cautiously looking around/vocal response, 3-completely afraid and left the area) after every trial (Lanier, 2000). After categorizing the data on the scale, we analyzed it by comparing the mean responses of the organisms using the one-way ANOVA test to see if the two species reactions were statistically different.

In correlation with mallard ducks, the investigators looked to test the same innate fear in humans. The researchers tested the type of reaction in response to a fear that such organism learned to react to. A pre-recorded audio clip of a stern male voice saying “Watch out!” was used because of its reputation for signaling when there is danger and should elicit a fight or flight response. The audio clip was recorded by one of the researchers through on an iPhone. This is considered a learned stimulus because language is something that must be taught; the meaning of the words are not known from birth (Loughry & McDonough, 1988). A bluetooth speaker was set up about two meters from the subject and the advisory tone was played once, to simulate a real learned stimuli. The speaker was hidden in a patch of long grass to ensure subjects would not suspect anything. The reactions of the specific subject, along with the subjects around it were recorded. The subject’s reactions to the sound was recorded, as previously explained, with video recording and handwritten observations. These steps were repeated with other subjects to determine an average response amongst the humans with at least 10 minutes between each trial. A control trial of a recording of cricket vocalizations was played for five minutes on the same bluetooth speaker to ensure the speaker was not causing any reaction. The reaction of the human was graded on the same scale as the other trials with a 0 to 3 ranking (0-no reaction, 1-some reaction, 2-cautiously looking around/vocal response, 3-completely afraid and left the area). After categorizing the data on the scale, we analyzed it by comparing the mean responses of the organisms using the one-way ANOVA test to see if the two species reactions were statistically different.

Researchers conducted gel electrophoresis by using Gold Bio 100 bp ladder and cheek cell DNA from the researchers. The gel was composed of 0.5 g Agarose, 5 mL of 1x TBE buffer, and 47.5 mL of water. The solution was then placed in the microwave in intervals of 15 seconds until it was hot. Once it was hot enough, it was cooled to a lukewarm temperature and 5 μL of SYBR safe fluorescent dye was added. The solution was then placed into the mold and placed into the cooler until the gel was solidified. Cheek cell mtDNA isolation and purification was then done by first collecting spit from all researchers. Spit then sat in a 15 mL tube for 20 minutes, and after 20 minutes the cells at the bottom of the tube were pipetted into two 2.0 mL microcentrifuge tubes. The capped 2.0 mL tubes then spun at full speed in a microcentrifuge for 5 minutes, and a much liquid was poured off as possible from the top of the tubes afterwards. 100 μL of Chelex resin was then added and respun in the microcentrifuge in the same manner. The tube was then suspended at 100ºC for 10 minutes. Tubes were then placed on ice for 3 minutes, and afterwards respun in the microcentrifuge in the same manner and previously explained. The liquid was then transferred to a clean 1.5 mL tube. The Gold Bio 100 bp ladder and purified cheek cell DNA were both pipetted into solidified gel. The gel electrophoresis was then run for 20 minutes.

Mallard ducks and humans appeared to have a more extreme response when exposed to an innate fear-based stimuli. A level 2 reaction from the ducks or humans was seen when they elicited a startling movement or auditory response, which was mainly seen when ducks and humans were presented with an innate stressor.(Figure 1A). A level 3 reaction from ducks or humans was observed when they were completely frightened by the stressor and fled the area (Figure 1B). Mainly seen when ducks and humans were presented with an innate stressor. Out of the 28 observed ducks, 16 responded moderately scared, which was scored as a 2, and making it the most common response to the innate stimulus (Figure 1C). Comparatively, 16 out of the 26 humans exposed to the same innate fear-based stimuli responded with a score of 3, making it the most frequent degree of response (Figure 1C). The humans had more higher degree responses as compared to the ducks. The ducks had an average score of 2.125, while the humans had an average score of 2.476 (Figure 1D). There is no statistical significance between the two species average reaction rating when put through a one-way ANOVA test (Figure 1D). This suggests that the mallards and humans have statistically comparable reactions. The control stimuli for both mallards and humans had little to no reaction, as expected.

When compared with the innate fear, both the mallard ducks and humans react less severely. A level 0 reaction from both ducks and humans was seen when no reaction was displayed from the stimulus presented (Figure 2A). This was rarely seen in ducks and humans when presented with a learned stressor. A level 1 reaction from both ducks and humans was also seen when they acknowledged the stimulus presented, which was mainly expressed from either ducks or humans turning their head (Figure 2B). This reaction was commonly seen when subjects were presented with a learned stimulus. When exposed to an audio learned fear, the duck (n=31) reacted with a response quantified on our scale as a 1 51.6% of the time, which is the most common response (Figure 2C). When humans (n=32) were exposed to the voice playback, they responded with a head turn 62.5% of the time (Figure 2C). Ducks responded with an average fear response of 1.13 on the scale when exposed to the learned stimuli (Figure 2D). Humans responded with an average of 1.26 on the scale when exposed to the similar learned fear (Figure 2D). Both controls in this experiment received little response when exposed to ducks and humans with an overall an average response of 0.081 (Figure 2D). After performing a one way ANOVA statistical test, it was found that there was no statistical difference found between duck’s response and human’s response to learned stimuli.

The flight response is more prominent in both species when exposed to innate stimuli than learned stimuli. Based on the reactions of both species to their innate and learned cues, investigators then determined whether these responses were expressed through fight or flight reactions. Flight was seen as swimming/flying away or walking/running away along with flinching from or turning head towards threat. Fight was seen as speaking aggressively at and physically moving at the cue. The NRSF silencer on the ADRA2C gene that is found in humans will show a significantly higher fight response and overall reaction intensity than the ducks to both fight and flight cues (Lee & Choi et al, 2018). It was observed that when humans were presented with a sudden movement stimuli, they evaded the potential threat and displayed irritated facial behaviors. When ducks were tested with sudden movement, they immediately swam away and occasionally aggressively vocalized at the researcher who performed the sudden movement. Ducks showed an 11% higher occurrence of fight responses when presented an innate cue (Figure 3A). Humans had a fight reaction 2 out of the 14 times while ducks reacted 2 out of the 8 times in the same way (Figure 3B). In response to the learned trial, humans showed a 6% higher fight response compared to ducks. Humans reacted with a flight response 1 out of the 16 times while ducks never had a flight reaction of 19 observation. Ultimately, there was no significant difference in flight reactions of the species, but there was a significant difference in the species, as previously predicted.

The ADRA2C gene was found on the 4th chromosome in humans. The ADRA2C gene is amplified using the forward primer 5’AGTGGGCAGGGCGGGCAGGT 3’, and the reverse primer 5’CGCTGCCTCCCTTCCACCTGTTG 3’(Barr, 2001). The amplification starts at the base pair 4481 and extends to the base pair 4663. The amplification of the target sequence of the gene was 183 base pairs long (Figure 4A). Gel electrophoresis was done and Gold bio 100 bp was loaded into the first well and used as a ladder (Figure 4B). The well labeled C was loaded with human buccal DNA from researchers. The streak seen in well C was the fluorescent dye used, not the DNA. Readings seen inside the well, where it was loaded, was DNA as a result of its size. A reading for the amplified target sequence of the ADRA2C gene would be seen in the gel where the arrow points to in well C, based on the target sequence length.

Figure 1. Degree of Reaction of Anas platyrhynchos and Humans to Innate Stimuli measured on a reaction scale of increasing severity. Scale depicting degree of response is ranked in whole positive integers from 0 to 3; the higher the number, the more severe the reaction. Unexpected clapping was innate stimuli in both humans and Anas platyrhynchos. Anas platyrhynchos n=28, Humans n=26. Controls are also displayed in both parts of the figure. A) A reaction level of 2 is displayed by the duck because the duck is responding to the innate stimulus. The duck is shocked, but does not swim away and is not completely frightened by the stimulus. B) A level 3 reaction is shown here by the duck because it is completely frightened by a similar innate stimulus. The duck moves and flies away quickly. C) Percent of each reaction degree for Anas platyrhynchos and humans. Controls included to emphasize that the reactions are due to stimuli, not researcher's procedures. D) Average degree of response per stimulus. Error bars included to show divergence of trials from their species-specific mean. Because error bars overlap, which shows no statistical difference. ANOVA one-way test used to find the mallard and human mean of the results are not statistically significant from one another. Control averages included to serve as baseline and help express statistical significance of test trials.

Figure 2. Degree of reaction of the Anas platyrhynchos and humans to learned fear playbacks measured on a scale of 0-3. Scale quantifies fear response in a positive whole number ranging from 0-3, increasing in severity of fear response. A) A reaction level of 0 is shown, meaning there is no reaction displayed by the duck. The duck in this figure is just cleaning itself in its natural habitat. B) A reaction level of 1 is shown here, where the duck is responding to a learned stimulus. The duck turns its head showing a small response to the stimulus presented. C) Percentage of responses of Anas platyrhynchos (n=31) and humans(n=32), respectively, reacting to learned fear playback. D) Mean reaction of Anas platyrhynchos during i) Red-Tailed Hawk playback and ii) Chickadee playback compared to mean reaction of humans during i) Voice Playback and ii) Cricket Playback. Error bars were included to represent variability in the collected data and uncertainty in the measurements. ANOVA one-way test was used to find the mallard duck and human mean of the results are not statistically significant from one another, which is also displayed in the overlapping error bars.

A. B.

Figure 3. Fight or flight responses to innate and learned tests were graphed on a 0-100% scale. A) The percent of fight and flight responses for humans and ducks to an innate cues was graphed. 26 humans and 28 ducks were tested with a sudden movement from a scientist to test their instinctual reaction. 38% of humans responded with a flight respond while 62% responded with a fight response. 68% of ducks reacted with a flight response and 29% retaliated with a fight response. B) The percent of fight and flight responses for humans and ducks to learned cues is shown. 32 humans were tested with a male voice playback from a speaker that said 'Look out!' and 31 ducks were tested with a red tailed hawk playback (Refer to the 'methods' section for more details). 84% of humans responded with a flight response while 6% responded with a fight response. 74% of ducks responded with a flight response while 6% responded with a fight response.

A. B.

Figure 4. Display of primers used to amplify a target sequence of the ADRA2C gene on human genomic sequence of chromosome 4, and a display of gel electrophoresis. A) The total base pairs of the amplification of the ADRA2C gene are shown. The amplification will result in 183 base pairs being replicated. The forward and reverse primers are highlighted in yellow, and arrows point in the direction in which they move. B) A picture of gel electrophoresis is shown with the Gold Bio 100 base pair ladder in the well furthest to the left labeled A. The well labeled B is empty, and the well labeled C was loaded with human DNA. The base pair length of the ladder is shown and labeled to the left. The target sequence of the ADRA2C gene would be seen where the arrow points to in well C.