Environmental factors and genetics are significant in explaining evolutionary behaviors across species. Through natural observation, stress related negative behaviors of Mallard ducks and humans were observed in different stressful and non stressful environments. PCR was performed on human DNA, using agarose gel electrophoresis to identify the presence of the COMT gene in which accounts for behavioral stress management. The purpose was to understand how increased levels of stress can lead to a change in negative behavior for Mallard ducks and Humans through COMT activation. It is hypothesized that if the COMT gene is present in the organism, a measurable change in behavior and group social interactions can be seen if a stressful environmental factor is present. We predict that the COMT gene is activated at higher frequencies in organisms that are present in stressful environments as stress factors increase corticosterone levels in the brain, in which is maintained by enzymes such as catechol-O-methyltransferase (Dallman et at., 2004). The significance in science this research holds is to allow for better understanding on how environmental factors and genetics are connected to specific evolutionary behaviors across species.

Male and female Mallard ducks, known as Anas platyrhynchos, rely on auditory and visual processing of an environment for survival, as do humans (Pease et al., 2005). Through evolution and adaptations, ducks and humans have both learned to identify and classify environmental stimuli as either favorable or detrimental to the organism's well being. Once a specific stress inducing sound or sight is identified by a duck, observable behaviors change to favor the surrounding conditions, these mostly being negative behaviors such as aggression (Zimmer et al., 2011). Negative behaviors are a direct response due to changing physiological conditions present in an organism, as corticosterone and neurotransmitters determine an appropriate behavior to a stress inducing stimuli. Due to the ease at which negative behaviors can be identified will allow for observations to be tracked to specific members of the group and classified appropriately. Humans also display similar behavioral characteristic changes when stimulated by stressful senses, this allowing for in depth research to be performed to characterize how frequent these changes occur (Papaleo et.al 2008).

Mallard ducks, a primarily social species, are commonly observed traveling in groups or partnerships, as they live among each other in pairs during specific times during the year. Mallard ducks communicate due to several different reasons, the most frequent reason being for mating purposes and defense mechanisms. Ducks implement specific behavioral changes when stressful factors are present in the surrounding area, these most commonly including a warning calls along with the fight or flight response. Male Mallard ducks will hiss when they feel threatened, eventually resorting to attacking either other males fighting for dominance or predators threatening their survival. When stress factors such as predators are present in an environment female ducks are defending their nest while male ducks resort to defending themselves (Gunness et. al 2002). Through research performed by Melissa Pease, Robert Rose, and Mark Butler, it was determined that human disturbances, through indirect interaction with wildlife such as the Mallard duck, cause stress induced physiological and behavioral change as animals expend tremendous energy to avoid human interaction (Pease et al., 2005). Understanding how humans act as a stress inducing factor in the environment for animals allows for a more in depth look at how stressful situations can influence negative behaviors in wildlife.

Humans (Homo sapiens) are known to be a very social species while constantly communicating through verbal speech and non-verbal body language (De Gelder et. al 2011). Facial cues are alternative examples of communication that are essential to the components of studying human interactions because they can reveal certain emotions and thoughts of individuals (Meeran 2013). In an extension of body language, certain actions such as approaching or going away from a stimulus disclose specific emotions depending on the surrounding environment. This can be related to the evolutionary stress response exhibited in both humans and animals known as the “fight or flight.” Stressful factors present in specific environments result in behavioral changes leading to more aggressive behaviors and negative body language and facial expressions (Roelofs 2010). This connects with the idea that humans are wired with certain instincts; the most powerful one being survival and overcoming stressful situations (Bracha et.al 2004).

With the presence of stressful factors in an organism's environment, aggressive behaviors, classified as negative behaviors, begin to increase whether in a solitary or social group setting due to neurochemical events (Summers et al., 2006). These behavioral events will be studied through various natural observation as well as the use of a polymerase chain reaction (PCR) to amplify the gene COMT, that works to aid in the homeostatic process of maintaining and controlling these neurochemical events. Negative behaviors that result from anxiety and the introduction of stressful factors can be linked to the prefrontal cortex of the brain, where neurotransmitters including norepinephrine and dopamine allow for certain signal processing in an organism (Montag et al., 2012). The gene COMT, in which produces catechol-O-methyltransferase, seeks to control levels of neurotransmitters and hormones present in the synapses of the prefrontal cortex, allowing for regulation of behaviors related to stress and anxiety (Montag et al., 2012). Through performing PCR on human genetic information, identification of specific bands allowed for the presence of COMT to be confirmed and for behaviors witnessed through observational study to be more accurately compared to why aggressive behaviors were witnessed as stress in the environment increases.

We predict that the COMT gene is activated at higher frequencies in organisms that are present in stressful environments as stress factors increase corticosterone levels in the brain, in which is maintained by enzymes such as catechol-O-methyltransferase (Dallman et at., 2004).

Naturalistic observation was conducted near the northeastern corner of Wells Hall on the Bank of the Red Cedar River during the fall of 2019. Experiments extended over the course of two months and results were recorded in Microsoft Excel and through hand notes. Videos were recorded using an iPhone XS at 60 fps at 1080p and pictures were taken through two 12-megapixel cameras, one wide-angle and one telephoto. Behaviors were observed and noted at the scene as well as reinforced through video evidence and negative behaviors were classified through the behavioral-classification scale in McKinney’s work, this being aggression, mating practices, fleeing or flight, and defensive behavior (McKinney, 1978).

Various experiments on how human activity alters behavioral responses of the Mallards were conducted as performed through Mellisa Pease’s prior research. The study was carried out in the same area as naturalistic observation at Wells Hall, implementing different human activity: biking, running, and walking into the area surrounding the Mallards, as these were shown to have greatest stressful effects on ducks (Pease et al., 2005). Behaviors of the ducks were recorded and distance of the ducks were calculated from the site of applied human interference, measured in yards with a Bushnell rangefinder (Tarjuelo et al., 2015). Group size of the Mallard Ducks were recorded at specific times, classifying the Mallard members by gender to distinguish between different observed behaviors between the social group.

Studies of human activity and negative behavior response to stressful situations were conducted during the same months as the Mallard studies, this being September and October. Samples of 4 students were randomly selected for each trial, their negative behaviors recorded in notebooks during observation in the Snyder-Phillips Hall cafeteria and Wells Hall exam rooms on the campus of Michigan State University. Locations were determined based on the effect school assigned responsibilities contributed to stress levels of student subjects, stress being high in exam like scenarios while low stress factor environments included dinner breaks and lunch breaks for students on campus. Facial expressions were classified from methods of Dr. Matsumoto, classifying negative emotional recognition through specific facial muscle movements; these including furrowed brows, flared nostrils, or lips pressed together (Matsumoto et al., 2011). Five trails of observation on subjects in the sample were carried out to inhibit the faulty inference of researchers misinterpreting facial expressions and body language from skewing results.

In order to account for any distinction between male and female aggressive and negative sexual behaviors based on mating season, Mallards were observed both out of mating season (September) and during pairing season in October and November (Mckinney et al., 2018). This control was observed in Drilling, Titman, and Mckinney’s work on the background of Mallards and specific mating seasons, as ducks exhibit an increase in negative behaviors during mating and hatching season (Mckinney et al., 1978). Mallard ducks were viewed at different levels of human interaction: Michigan State University at the Red Cedar River near the northeastern corner of Wells Hall and at Crego Park in East Lansing, Michigan. The Red Cedar River location at Michigan State University presented high human interaction, and Crego Park in Lansing, Michigan showed low human interaction. The two locations were included in the research in order to control for differences in behavior between tame and wild Mallards, this method adopted from Frank Mckinney’s work on closely related species of birds (Mckinney, 1978).

A polymerase chain reaction (PCR) was performed on human DNA supplied through cheek cell mtDNA isolation and purification in the lab to create ample samples in which PCR could properly be performed. The polymerase chain reaction was based on prior research to the COMT gene using the forward primer of 5' GTGCTTTGAAGATGCCGGAGGC 3' and reverse primer of 3' GTGTGCTTTGCATTTAGGACACA 5' (Papaleo et al,. 2008). 2 µl of each the forward and reverse primers, 10 µl of DNA, .50 µl of DNTP, .50 µl of heat resistant taq polymerase, 2 µl of MgCl2, 5 µl of a reaction buffer, and 28 µl of PCR sterile water were pipetted into a 2mL Eppendorf PCR tube and then placed into the thermocycler. The process was denatured at 95 degrees celsius for five minutes, followed by denaturation and annealing for segments of thirty seconds each and extension for one minute for 32 cycles and ended with extension for one ten minute period. Annealing and extension were performed at 55 degrees celsius and 72 degrees celsius respectively (Papaleo et al,. 2008).

An agarose gel was prepared while the PCR ingredients were in the thermocycler. .5 grams of 100 percent agarose, 5 mL of the buffer Lithium Borate, and 45 mL of deionized water were combined in a 250 mL erlenmeyer flask and heated in a microwave in 30 second intervals for a total of 1 minute, while using autoclave gloves to swirl the mixture to help the solute dissolve. After the solution had cooled for 5 minutes, 5 µl of the SYBR dye was pipetted into the solution, and the solution was poured into the casting tray in order to act as a mold for the gel and the comb was inserted for the formation of the wells by its teeth.

Once the solution had formed a gel after about 20 minutes, the comb was removed and a buffer solution containing 12.5 mL of Lithium Borate and 250 mL of deionized water was poured into the 250 mL tank (gel electrophoresis unit) and used to help aid in the flow of charge. 5 µl of the DNA ladder; which contained the known values for the base pairs, was pipetted into the first well. 4 µl of a mixed solution each containing 3 µl of tracking dye and 9 µl of the PCR solution was pipetted in the second and third well. The gel electrophoresis parts were assembled and the red electrode (anode) was connected to the positive terminal, while the black electrode (anode) was connected to the negative terminal. Agarose gel electrophoresis was then performed at 160 volts in the direction from the cathode to the anode for 25 minutes in order for the molecules to move down their lane at least halfway through the porous gel matrix. The bands were photographed under ultraviolet light to determine base pairs.

To analyze data, all naturalistic observations were converted to averages and proportions corresponding to numbers of negative behaviors observed and were then weighted with sample size of duck and human participants to allow for fair comparison. The results from naturalistic observation and the corresponding observed negative behaviors were run through statistical z tests and t tests of 95% significance (P< .05) with nonsignificant observations be noticed from our original models.

Mallard Ducks and humans exhibited variation in negative behaviors according to the amount of stressful factors that were present in the surrounding environment. Of the total humans observed (n=44), humans in stressful environments (n=17) showed increased levels of aggressive behavior than that of humans outside of stress factors (n=27). Humans in a stressful environment and less stressful environment, on average, exhibited negative behaviors at rates of 71% (x=0.7058) and 59% of the time(x=0.5925) respectively (Figure 1a). Of Mallard ducks, the ducks located on campus (n=119), showed higher amounts of negative behaviors towards one another than off campus ducks (n=36). Mallards present in a stressful environment and less stressful environment, on average, exhibited negative behaviors at rates of 71% (x=0.7143) and 33% (x=0.332) respectively (Figure 1b). Through the use of a 2-sample z-test, significance was found (p<.05) at the 95% level between negative behaviors in on campus and Crego park ducks.

Behavior of male and female Mallard ducks were observed along the Red Cedar River behind Wells Hall in East Lansing, Michigan and ducks were also observed off campus at Crego Park along the Red Cedar River in Lansing, Michigan. The average proportion of ducks performing a specific behavior were calculated for on campus and off campus ducks (Figure 2). On campus, attacking and defending had a higher average proportion compared to off campus attacking and defending behaviors. Aggression in on campus ducks, with an average of 0.4993, was found to be higher in respect to off campus ducks, showing aggressive behaviors with an average of 0.078 (Figure 2). The sample sizes ranged from 15-25 ducks over the course of 10 observation days. The sample size for off campus ducks ranged from 4-11 ducks over the course of 10 observation days. Defending for on campus ducks was found to have an average of 0.5035 and was found to be higher than off campus ducks with an average of 0.131 (Figure 2). The error bars represent 1 standard error.

Data collected through observation shows the average distance that Mallard ducks moved away from human passersby based on differing locations. On average, male and female Mallard ducks on the Red Cedar River northeast of Wells Hall at Michigan State University moved away from humans to an average distance of 2 yards (Figure 3). Male and female mallard ducks at Crego Park in East Lansing, Michigan, moved to an average distance of 12 yards in the presence of walkers (Figure 3). In the presence of bikers, on campus Mallards at the same location moved to an average 5 yards away, and Crego Park Mallards moved to an average of 8 yards (Figure 3). When runners passed by, on campus Mallards at the same location moved to an average distance of 9 yards, and Crego Park Mallards moved to an average of 15 yards (Figure 3). The average distance that ducks moved away from humans was measured with a bushnell laser rangefinder. A statistical z-test was used to look for significance in averages of distance that Mallards moved away from humans.

Gel electrophoresis and PCR were used to separate specific splices of DNA, or target DNA, in order to study an amplified copy of that specific gene. The bands of DNA shown to the right of the ladder correspond to the base pairs present at that band in the ladder. The largest strands are found closest to the top of the well because because they are too heavy to travel further through the gel. The smaller strands were found further down the well due to size of genetic material (Figure 4). Material shown in a darker band correlate to higher DNA concentrated at those specific base pair lengths. The bands closest to the wells at the top contain around 1500 base pairs and the bands that fall below the 100 base pair band have around 50 base pairs. The COMT gene in humans found on the 108th base pair (Figure 4).

Bracha, S. H., Ralston, T. C., Matsukawa, J. M., Williams, A. E., & Bracha, A. S. (2004). Does “Fight or Flight” Need Updating? Psychosomatics, 45(5), 448–449. doi: 10.1176/appi.psy.45.5.448

Dallman, M. F., Akana, S. F., Strack, A. M., Scribner, K. S., Pecoraro, N., La Fleur, S. E., … Gomez, F. (2004, June). Chronic stress-induced effects of corticosterone on brain: direct and indirect. Retrieved from https://www.ncbi.nlm.nih.gov/pubmed/15240363.

De Gelder, B., & Van den Stock, J. (2011, August 9). The Bodily Expressive Action Stimulus Test (BEAST). Construction and Validation of a Stimulus Basis for Measuring Perception of Whole Body Expression of Emotions. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3152787/.

Drilling, N., Titman, R. D., & Mckinney, F. (2018). Mallard (Anas platyrhynchos). The Birds of North America Online. doi: 10.2173/bna.mallar3.01.1

Gunness, Michelle A., and Patrick J. Weatherhead. “Variation in Nest Defense in Ducks: Methodological and Biological Insights.” Journal of Avian Biology, vol. 33, no. 2, 2002, pp. 191–198., doi:10.1034/j.1600-048x.2002.330211.x.

Matsumoto, D., & Hwang, H. S. (2011, May 1). Reading facial expressions of emotion. Retrieved from https://www.apa.org/science/about/psa/2011/05/facial-expressions.

Mckinney, F. (1978). Comparative Approaches to Social Behavior in Closely Related Species of Birds. Advances in the Study of Behavior, 8, 1–38. doi: 10.1016/s0065-3454(08)60130-8

Meeren, H. K. M., Gelder, B. de, Ahlfors, S. P., Hämäläinen, M. S., & Hadjikhani, N. undefined. (2013, September 6). Different Cortical Dynamics in Face and Body Perception: An MEG study. Retrieved from https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0071408.

Montag, C., Jurkiewicz, M., & Reuter, M. (2012, March 2). The role of the catechol-O-methyltransferase (COMT) gene in personality and related psychopathological disorders. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4345409/.

Papaleo, F., Crawley, J. N., Song, J., Lipska, B. K., Pickel, J., Weinberger, D. R., & Chen, J. (2008, August 27). Genetic dissection of the role of catechol-O-methyltransferase in cognition and stress reactivity in mice. Retrieved from https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2561993/.

Pease, B., & Pease, A. (2008). The Definitive Book of Body Language: The Hidden MEANING Behind People's Gestures and Expressions. Retrieved from https://books.google.com/books?id=z5d_8bAyW8AC&printsec=frontcover&source=gbs_ge_summary_r&cad=0#v=onepage&q&f=false

Pease, M. L., Rose, R. K., & Butler, M. J. (2005, November 20). Effects of Human Disturbances on the Behavior of Wintering ... Retrieved from https://www.researchgate.net/publication/261826106_Effects_of_Human_Disturbances_on_the_Behavior_of_Wintering_Ducks.

Roelofs, K., Hagenaars, M. A., & Stins, J. (2010, September 28). Facing Freeze: Social Threat Induces Bodily Freeze in Humans - Karin Roelofs, Muriel A. Hagenaars, John Stins, 2010. Retrieved from https://journals.sagepub.com/doi/full/10.1177/0956797610384746?casa_token=VbbgEKqG_ggAAAAA:6AkPcRp0ua5fO21SSF0sgQseDVb49moSed6f-wTsN_n8r8bdqYabJW40e5NWhbxNIVfHBeK_WKc-8Q.

Summers, C. H., & Winberg, S. (2006, December 1). Interactions between the neural regulation of stress and aggression. Retrieved from https://jeb.biologists.org/content/209/23/4581.short.

Tarjuelo, R., Barja, I., Morales, M. B., Traba, J., Benítez-López, A., Casas, F., … Mougeot, F. (2015). Effects of human activity on physiological and behavioral responses of an endangered steppe bird. Behavioral Ecology, 26(3), 828–838. doi: 10.1093/beheco/arv016

Zimmer, C., Boos, M., Robin, & Petit, O. (2011, April 20). Behavioural Adjustment in Response to Increased Predation Risk: A Study in Three Duck Species. Retrieved from https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0018977.

C

Figure 1: Human and Mallard Negative Behavioral Responses to Stress. A, Presence of performed negative behaviors in response to different environments, stressful and stress-reduced. Negative behaviors include physical behaviors of anger, hands on the head, and negative facial expressions; furrowed brows, flared nostrils, or lips pressed together. A total of 44 individuals were observed, the sample size for stressful environments (n=17) and less stressful environments (n=27) being observed at different times for the month of October. Humans in a stressful environment and less stressful environment, on average, exhibited negative behaviors at rates of 71% (x=0.7058) and 59% of the time(x=0.5925) respectively. Assuming independence, a right-tailed 2-sample z-test was performed and showed no statistical significance between the groups (p>.05). Error bars represent approximately 1 standard error. B, Average number of negative behaviors performed by Anas Platyrhynchos dependent on environmental stress. Negative behaviors consisted of aggression towards others, attempts to mate, defensive behaviors, and fleeing the area of observation. A total of 155 members of Mallard ducks were observed, the sample size for the stressful environment of the Michigan State campus by Wells Hall (n=119) and less stressful environment of Crego Park in East Lansing (n=36) being observed 7 different times during the month of October. Mallards present in a stressful environment and less stressful environment, on average, exhibited negative behaviors at rates of 71% (x=0.7143) and 33% (x=0.332) respectively. Assuming independence of behavioral observations, statistical significance was determined between the two sets (p<.05) using a 2-sample z-test. Error bars present represent 1 standard error. C, Represents negative behavior of aggression performed by Mallards present at the campus of Michigan State University.

Figure 2: Observed Behaviors in Mallard Ducks. Behaviors were observed by male and female Mallard ducks in an on-campus environment (blue bars) and off-campus environment (red bars). The ducks who performed a certain behavior, such as attacking, defending, and tail wagging, was measured and the amount was recorded. The proportion of duck behavior compared to their sample size was measured to keep the data statistically similar. The average proportion of each behavior over the course of the 10 days of observations were added together and the average of the data was found for every behavior for on and off campus ducks. Aggression in on campus ducks, with an average of .4993, was found to be higher than off campus ducks with an average of .078. Error bars represent .1 standard error. The sample size included both male and female ducks. All three of the behaviors observed were negative behaviors, meaning that they showed some sort of aggressive behavior. Defending and attacking data proved our prediction that on campus ducks will show more aggression than off campus ducks.

Figure 3: Distance Mallard Ducks Moved Away from Humans. Variation of average distance male and female Mallard ducks moved away from human passersby based on differing locations. Graphical data represents a one hour observation of a set sample of ducks at each location and how they reacted to human presence. The graph shows the average distance an individual duck moved away from a given human in yards. Campus duck sample (n=18) included male (n=10) and female (n=8) Mallard ducks northeast of Wells Hall on the Red Cedar River. The Crego Park sample (n=14) consisted of male (n=5) and female (n=9) ducks that were observed in their natural environment. Each column categorizes passersby as walkers, runners, or bikers. The two locations are represented on the graph by different colors of bars; on campus (red) and Crego Park (green). The average distance measurement was taken with a Bushnell rangefinder. A statistical z-test was used to find significance between locations for each type of passerby with a p-value of less than 0.05 for all categories. This was noted with an asterisk above each data set.

Figure 4: Gel Electrophoresis and PCR of Human DNA. Gel electrophoresis is used to separate DNA based on their size. The largest strands are found closest to the wells at the top because they take more time to travel down the well, whereas the smallest strands are found further down because they weigh less, which means they travel faster. The bands on the left are part of the ladder, which was GoldBio’s 100bp DNA ladder, which was used as our reference point for amount of base pairs present in our DNA. Each line that is to the right of the green ladder is a band of DNA that is similar in weight and size. The darker the band, the higher the concentration of DNA is in that band. The bands closest to the top have around 1500 base pairs and the bands closest to the bottom have around 100 base pairs. The bands that are present below the 100th base pairs are around 50 base pairs long.

Figure 5: Film Documenting Mallard and Human Behaviors. This documentary film was made and uploaded during the months of research and covers the content of the study performed on human and Mallard duck negative behaviors.