Finalized by: Tim Nguyen

      Black-capped chickadees, or Poecile atricapillus, are a relatively common songbird found in many parts of North America and are one of the most well known birds in Michigan (Lindsay, 2011). They are known to be found all over the state, and tend to be frequently at bird-feeders. Since our observations were done at bird feeders, the chickadee was an ideal choice for our research. They are a non-migratory species which will allow us to study them throughout the semester, even as winter approaches. They tend to form mating pairs during breeding seasons within the specific territory which they defend (Campbell et al., 2016). In the winter months, when they do not breed, they create flocks with structured social rankings (Campbell et al., 2016). Chickadees are quite easily recognized by several defining features including their black cap and bib, as well as their tan breast and grey wings. Chickadees are a sexually monomorphic species, meaning that there is not a clear physical distinction between male and female members (Campbell et al., 2016). Because of this, the behavior of the species will be observed as a whole, rather than distinguishing the aggressive behaviors of males in comparison to females. This will be considered when observations are being conducted.

      Due to bird feeders being a primary source of food for many species, it is common to observe aggressive behaviors to "compete" for the food from them. The bird feeders behind Holmes hall provide food for many different species, including goldfinches, cardinals, and red-headed woodpeckers, among many other species, so the competition between species may cause aggression both inter and intra specially (Piaskowski et al., 1991). One of the most interesting topics in animal behavior is aggression. Watching aggressive behaviors in animals can help us to better understand our own innate aggressive reactions. One of the common reasons for aggression is due to intrusion or feeling threatened, whether that be their resources or their lives. An intruder in this case would be considered any other bird approaching the feeder while the black-capped chickadee is present. Animals tend to behave either aggressively or timidly when they are feel some sort of threat, which may consist of an animal within or other than one of their own species (Piaskowski et al., 1991). This research focuses on the differences in aggression between chickadees in the presence of an intruder versus when they are in the presence of members of their own kind. By better understanding the variation in reactions to the presence of others, we will be able to better understand the aggressive reactions of humans when in the presence of others as an instinctual behavior. But first, we must define aggression and the characteristics we are searching for.

      Aggression in general, can be defined as any intentional verbal or physical interpersonal interaction, any unprovoked physical or verbal assault that is used to cause harm to a person or persons (Krishnaveni and Shahin, 2014). Interpersonal relationships (such as siblings) are good to study verbal aggression. People are surrounded by strangers everyday in different situations. Such situations in a college or a grocery store, makes certain verbal and physical aggressive behaviors more prominent (Rocca and Vogl-Bauer, 1999). We are examining both aspects of aggression in humans during home sporting events on Michigan State University's campus. Spectators' behaviors are dependent on the game situation. Studies have shown that there are higher levels of aggression when there is a big difference between scores (Krishnaveni and Shahin, 2014). We define "aggressive behaviors" as demeaning chants directed at the opposing team, as well as physically dismissive and competitive symbols in order to distract them from their goal. "Non-aggressive behaviors" consist of team building chants used to lift the spirits of players as well as other fans. By attending sporting events, we will further understand the different chants and physically aggressive behaviors and compare these findings with those of the behaviors of the chickadees. In the case of these sporting events, the "intruders" would be defined as the members of the opposing team as well as the spectators supporting the opposing teams. A closer look at genetic aspects of the source of this aggression can help to better understand the aggressive behaviors in humans as well as in chickadees. Following this information we must successfully figure out how these behaviors are linked to the genetic makeup of both humans and chickadees.

      Since birds are ancestors of humans there lies similar genetic makeup. Therefore aggression would be a derived trait and their behaviors would be very similar due to having similar genes. We can get a sample of a gene called MAOA and amplify it using PCR in a lab. This will make it possible for our experimental design to observe genetic similarities between humans and compare it to the genetic sequences of the black capped chickadee since birds do not have the MAOA gene specifically. Aggressive behavior in humans is linked to the enzyme Monoamine Oxidase A, which is regulated by the MAOA gene. Located on chromosome X position 11.3, it breaks down the neurotransmitters, dopamine, serotonin, and norepinephrine (Powledge, 2016). Although the gene has been related to antisocial behavior, MAOA is known as the "warrior gene." The term was identified in 1933 by an infamous violent Dutch family (Powledge, 2016). The amount of enzymatic behavior various from person to person. Someone with MAOA-L, the low-activity form produces less of the enzyme while the high-activity form (MAOA-H) produces more (Baum, 2009). A rare genetic disorder created by an MAOA mutation can lead to a deficiency of monoamine transmitters, which causes impulsive behaviors such as hypersexuality, sleep disorder and extreme mood swings, and tendency to violence (Hunter, 2010). This genetic disorder is known as Brunner syndrome (Hunter, 2010). The MAOA gene connects the phenotypic aggressive behaviors which can be verbally or physically damaging against objects or people, even against oneself (Shih et al., 1997). The chickadees could have some type of similar gene that expresses aggression in order to exhibit superiority to other species of birds, as well as their own kind. Dominance is associated with favorable access to food (Otter, 2007). By paying close attention to the audiences at sporting events, and chickadees at a bird feeder, we can monitor their actions and reactions based on any provocation of aggression in the presence of intruders. Once we have our data we can more accurately compare aggression between the chickadees and humans and possibly figure out why humans act aggressively in different situations. These situations include being with the same species, a different species, or by themselves. We predict there will be an increase in the MAOA gene in humans under a high provocation situation (McDermott et al., 2008) as well as rise in aggressive behaviors in chickadees when their food source seems threatened.

Black-capped Chickadee Observations

Finalized by: Emerald Horton

      The study done on the black-capped chickadee was purely observational with no manipulations. The birds were observed outside of Holmes hall at the disturbed bird feeder. This feeder allowed us to get as close as necessary to accurately observe the behaviors of the chickadees (Smith, 1996). All observations were taken during the months of October and November. The reason these months were used was due to the course deadline being November 22, 2016 and by ending the observations by the middle of November, allowed enough time to adequately analyze our data. Each feeder was observed 3 times a week for an hour at a time, thus making a total of 12 observational sessions per feeder. In order to incorporate randomization, the birds' behaviors were recorded at varying times.

      The birds were observed between the times of 12:00 pm and 4:00 pm, which is when the birds are most present at the feeders. This information was provided to the groups during lab by TA Anthony Watkins. During the month of observations each week was dedicated to a different time of day to study the birds' behaviors. The first week of observations were taken from 12:00 pm to 1:00 pm, the second week the birds were observed from 1:00 pm to 2:00 pm, the third week from 2:00 pm to 3:00 pm, and on the final week, from 3:00 pm to 4:00 pm. One of the controls used in this study was the black-capped chickadees' behavior when in the presence of their own kind. This was then used to compare their aggressive behaviors towards "intruders" (Piaskowski et al., 1991).

      In order to record aggression shown by the chickadee at the feeders, a digital camera owned by one of the lab members with and without a tripod was used to ensure consistant capture of the bird. When a digital camera was not available for usage an iPhone 6, which was owned by each of the lab members, was used to capture images and videos of the bird. The footage captured was later used to produce a five-minute-long documentary video of both the human and chickadee research. Quantified data was also recorded. The data being quantified was the amount of visits made by the chickadee when alone, when with other species of birds, and when with other chickadees. Also counts were kept of when the chickadees displayed aggressive responses in the presence of another species, non-aggressive responses in the presence of another species, aggressive responses in the presence of other chickadees, and non-aggressive responses in the presence of other chickadees (Smith, 1996). Then the mean was calculated for the quantified data of each single category that was recorded from 12:00 pm to 4:00 pm. While keeping quantified data, it was also necessary for there to be qualified data to provide a better idea of what types of aggressive and nonaggressive behaviors were observed.

Human Observations

      In order to understand how the MAOA gene functions in humans in the presence of intruders, an observational study was done, which specifically focused on its effects on human cognition and learned social behaviors. The behaviors of students at varying sporting events were studied and how they showed defensive social behaviors to the "intruders" (Raney and Kinnally, 2009). The intruders would include the spectators and players from the opposing team. The social behaviors observed were the chants exhibited by Michigan State University spectators before and during the first and second halves of the game. The chants were categorized as being either team building towards Michigan State University's (MSU) team, which are designed to support the team and encourage them, or demeaning chants towards the opposing team (Raney and Kinnally, 2009), which are used to discourage the opponents (intruders) success in the games. Amongst the chants, it was distinguished whether each of those were vocal, such as screaming "go green, go white", physical, such as clapping or making hand signals, or a combination of both vocal and physical chants, such as singing and dancing to the "MSU fight song". These behaviors were observed by attending home male football games, in East Lansing.

      All the home games attended were during the months of October and November. It was not possible to decide what days the athletic events would be studied, as the scheduling of the events was controlled by Michigan State University athletics. A total of three football games were observed, Brigham Young University, Northwestern, and University of Michigan games, which were all over the course of three saturdays during the month of October. The chants at each game were counted and recorded during the game. Once all the data was collected, it was averaged amongst all the games within the same sport. For example, the number of team building chants in the football games were averaged with the rest of the football games. After calculating these averages, bar graphs were created using "Excel", a Microsoft program. Pictures and videos were both taken during the game as well, they were analyzed to help provide examples for results (Raney and Kinnally, 2009).

PCR Methods

     Before the DNA region where MAOA is located undergoes the PCR process, the primers must be created. The primers: forward, 5'GAATCAAGAGAAGGCGAGTATCG-3' in reverse which is, 5'GGCAGCAGATAGTCCTGAAATG-3' (Shumay, 2012). The forward primer amplifies CTTAGTTCTCTTCCGCTCATAGC in the gene, the reverse amplifies CCGTCGTCTATCAGGACTTTAC in the gene. The PCR reaction used a 25 microliter volume with final concentrations of 1xPlatinum Taq PCR Buffer (Invitrogen), 1.5 mM MgSO4, 0.2 mM each of dATP, dTTP, dCTP and 7-deaza dGTP, 0.64 microliters of each primer, 1 unit of Platinum Taq polymerase (Invitrogen) and 1.6 microliters (~100-200 mg) of the DNA strand (Shumay, 2012). All these materials are provided by the Lyman Briggs organismal biology lab. Amplification of the DNA was performed with the BIO-RAD T100 thermocycler found in lab. The conditions included: initial denaturation at 95 degrees C for 2 min, 15 cycles of Touchdown at 95 degrees C for 30 seconds, 63 degrees C (decreasing 1 degree C each cycle) for 45 sec, 72 degrees C for 2 minutes and 30 seconds, followed by 20 cycles at 95 degrees C for 30 seconds, 48 degrees C for 45 seconds, 72 degrees C for 2 minutes and 30 seconds and a final extension at 72 degrees C for 7 minutes (Shumay, 2012). Making the gel, .7 % of 1g agarose gel was needed to mix with 50mL 1xTBE. To dissolve the mix even further, it was put into the microwave between 1-3 minutes covered and taken out every 45 seconds with a biohazard autoclave gloves to swirl and check for total disintegration. Once cooled for 5 minutes, the gel was then poured into a gel tray with the well comb. After solidification, the gel was inserted into the electrophoresis unit and the rest of the gel box is filled up to with the 1xTBE until the gel is covered. .2 /mL of SYBR dye was placed on PARAFILM "M" paper along with .3/mL of the DNA and mixed. Using a pipette, .5 /mL of the mixed liquids of the SYBR dye and DNA were released to the gel. The voltage of the gel will be run at 100 V. After the gel ran for 1.5 hours, the DNA fragment was sliced from the gel with a sterile razor blade and moved to an open Transilluminator UV box and into a microfuge tube. The tube with the DNA fragment had to be weighed by zeroing out the determine how much buffer would be needed to isolate it (Unknown, 2016). Isolating DNA required using a column purification kit (QIAquick Gel Extraction Kit) and followed the instructions provided and eluted 20 microliters of a TE buffer. Sequencing of the amplicons was performed using ABI 3130xl (Applied Biosystems) (Shumay, 2012). After the initial editing with the Sequencher program (Gene Codes), individual sequences were aligned against the reference genomic sequence (hg18) using CLUSTALW program (Shumay, 2012). The data was then recorded and analyzed.

Statistical Analysis

      In order to analyze the data gathered from the black-capped chickadee study, a 2-sample t-test, to test significance in the data obtained, was used. This method was ideal due to the fact that a single variable was measured amongst two different populations. This test was done using VassarStats in order to conduct hypothesis testing for the data in Figure 1. The aggressive behaviors were analyzed as the variable in question and what kind of bird the chickadee was in the presence of was observed as the variable we expect to elicit the response. The null hypothesis tested was that there was not a significant difference between the amount of aggressive responses when a chickadee was in the presence of another chickadee compared to when it was in the presence of a different species. This made the alternative hypothesis tested that there was a significant difference between the amount of aggressive responses when a chickadee was in the presence of another chickadee compared to when it was in the presence of a different species. Once there was enough data to provide enough power to create statistical significance, we conducted a 2-sample t-test and evaluated the t-value in relation to the p-value to determine statistical significance of the results. The results of the t-test were evaluated as statistically significant if the p-value was less than or equal to .05. The same statistical method will be applied to compare the non-aggressive behaviors in the same situations to determine if the responses to the different stimuli are statistically significant (Lowry, 2016). We also used an ANOVA statistical test to determine the significance of two variables (type of chants) over three populations of the human observations in Figure 2. (Lowry, 2016). The physical, vocal and both types of actions and quantified it based on if it was demeaning or teambuilding actions.

Results

Finalized by: Aleena Mirza

Aggressive Behaviors in Black-capped Chickadees

      Black-capped chickadees behaved more aggressively when in the presence of other black-capped chickadees for the duration of this study than they do when in the presence of other species of birds at the bird feeders. The average frequency of non-aggressive behaviors displayed by the chickadees (Figure 1A) is greater in the presence of a different species (average 9.67 times) than it is in the presence of another black-capped chickadee (average 2.33 times). This data was analyzed using a two-sample t-test and found to be statistically significant due to the p-value being less than 0.05 (t=2.68 and p= 0.018). Aggressive behaviors (Figure 1B) were more commonly displayed by the chickadee when in the presence of another black-capped chickadee (average 3.17 times) than when in the presence of a different species (average 0.833 times). Another two-sample t-test was conducted to determine statistical significance. A p-value of less than 0.05 determined that figure 1B was statistically significant (t = -1.71 and p = 0.069). The descriptive data (Figure 1C) showed that black-capped chickadees were alone (average 14.43 times) at the bird feeders more often than when they were with another species (average 12.14 times) or another chickadee (average 5.71 times).

Observed Human Behavior

      The distribution of demeaning (Figure 2A) and team building actions (Figure 2B) before and during the game. A two-sample t-test determined that there was a statistically significant difference between the demeaning chants before and during the game (Figure 2A) due to the p-value being less than 0.05. Demeaning chants were more likely to occur during the game (average 111 times) than to occur before the game (average 9 times) Demeaning chants are more likely to occur during the game than they are before the game (t= -5.9, p= 0.014). Statistical significance was also determined by the two-sample t-test when comparing the timing of the team building chants (Figure 2B) by the p-value being less than 0.05 by the t-test (t= -5.02, p =0.007). Team building actions are also more likely to occur during the game (average 67.67 times) than they are before the game (average 29 times).

      The average demeaning actions (Figure 3A) were stratified by the type of action displayed by the spectators as physical, vocal or both (physical and vocal). An ANOVA test determined that the data was statistically significant as a whole due to p< 0.05 (f= 9.54, p= 0.014). A Post-hoc Tukey test determined statistical significance (p<0.05) between physical (average 32.67 times) and vocal (average 56.33 times) and between vocal and both (average 28.00 times) but no statistical significance between physical and both (p>0.05). The average team building actions (Figure 3B) were also stratified by physical, vocal and both and an ANOVA test was conducted to attempt to determine statistical significance. This test, however, did not conclude any statistical significance (p>0.05). Due to the f- statistic not having any statistical significance, the Post-hoc Tukey test could not be conducted, so it is not possible to determine statistical significance between vocal, (average 27.67 times) physical, (average 28.33 times) and both (average 40.67 times).

PCR and Gel Electrophoresis

      Through the use of PCR we predict that we will be able to identify the MAOA gene in humans because PCR will allow us to amplify and replicate the strand of the MAOA DNA we are looking for (Shumay, 2012). In figure 4, the steps for the first cycle of PCR are displayed. We predict that our PCR product, when run through gel electrophoresis will yield a band at approximately 282 bp, 264 bp, or 246 bp which correspond to 7-repeat allele, 6-repeat allele, and 5-repeat allele, respectively (Karere, et al., 2012).