By: Abraham Flores, Monica Wimbush and Kristin Murphy
Michigan State University
LB 144: Cell and Organismal Biology
Section 009: Wednesday 7pm
Mellissa Ungkuldee and Kaleb Howard
9/22/2016
http://msu.edu/~floresab
Introduction
Social learning refers to learning that is influenced by observation of, or interaction with another animal, typically one that belongs to the same species or its products (Heyes, 2012). The foods an individual chooses to eat, the motor patterns it uses to gain access to food, the time it spends foraging in a patch, the predators it avoids, and the individuals it selects as sex partners all can be affected by the observations of others of its species (Galef and Laland, 2005). Social learning is an evolutionary tool that complex organisms such as humans and other vertebrates utilize to adapt to changes and ensure survival in an ever-changing ecosystem. The last two decades have seen a virtual explosion in research on social influences on the foraging behavior of nonhuman animals (Galef and Girldeau, 2001).
Like humans, many bird species depend on social learning to learn aspects of foraging such as feeding sites, food items, hunting skills, handling and feeding techniques, and tool usage (Slagsvold et al, 2011). Animals that participate in social foraging increase their foraging efficiency by using the sampling behavior of other group members to estimate the quality of the shared patch (Galef and Laland, 2005). Social foraging behavior includes a range of vocalizations, each sound having a distinct meaning for example, immature ravens are vagrant and accumulate rich food sources during the winter by flying towards vocalizations given by birds at carcasses (Marzlufi and Heinrich, 1991). Much of the research done involving the social foraging behavior of birds has concluded that the two main reasons birds forage in mixed-species groups are to (1) improve feeding efficiency and (2) reduce risk of predation but have yet to determine the genetic factors of social foraging (Sridhar, Hari, Beauchamp, and Shaker, 2009)
If birds use social learning as an evolutionary tool while foraging in groups we expect there to be some genetic influence on the social eating habits similar to those found in humans. In non-human mammals, receptors for the neuropeptides oxytocin (OT) and arginine vasopressin (AVP) are distributed in various brain regions associated with social behavior including prenatal care, pair-bonding, social memory, and social aggression (Heinrich et al, 2009). Converging evidence from both human and animal studies has highlighted the pervasive role of two neuropeptides, oxytocin (OXT) and arginine vasopressin (AVP), in mammalian social behaviours (Israel et at, 2008). To compare the OXT gene found in birds and humans, a PCR test was used. PCR is a simple, yet elegant, enzymatic assay, which allows for the amplification of a specific DNA fragment from a complex pool of DNA (Garibyan, 2013). By amplifying the bird's sequence, it can be compared to the human's sequence.
By observing the social behavior at two different bird feeders, we hypothesized that if there is an increasing number of birds at a feeder, then similar social eating behaviors will be observed because birds are social learners and their social behavior can be predicted by the OXT gene. OXT, which codes for oxytocin, in the genetic link for social behaviors in birds and humans. By using a radioactive compound that attaches to oxytocin-like receptors neurobiologist at Indiana University found when they blocked those receptors of oxytocin in female zebra finches, the birds became less social (Goodson, 2009). Observations seen at the bird feeder and observations of human social behavior in the cafeterias at Michigan State University were documented to determine social eating habits. We predict that birds will exhibit similar social eating behaviors to humans by displaying an increase in the number of birds at a feeder as time increases because many bird species also depend on social learning to learn aspects of foraging such as feeding sites, food items, hunting skills, handling and feeding techniques, and tool use (Slagsvold et al, 2011)
Methods
Bird Feeders and Observations
Over the course of four weeks (October 9 to November 6) we conducted observations during 11:00am to 12:00 noon and 4:30pm to 5:30pm on Thursday of each week. Each observation period consisted of the first 30 minutes observing the disturbed bird feeder (DBF) and the second 30 minutes observing the undisturbed bird feeder (UBF). The DBF and the UBF are physically identical, meaning their structure and food contained within them are exactly the same. The difference between the two feeders is how close observers are allowed to come to the feeder. Observers may come as close as possible to the DBF. The UBF however, can only be observed from the nature trail, approximately ten meters from the UBF. The feeders are located behind Holmes Hall in East Lansing roughly 30 meters apart. Figure 1 gives a map of the two locations with respect to Michigan State University's campus. The two feeders consist of three hanging cages, four hanging cylinders and a house feeder on the top, which can be seen in figure 2. We did not control the food in the feeders, the food was controlled by Michigan State University. The food found in the DBF and the UBF were; black oil sunflower seeds, sunflower hearts and chips, safflower and thistle.
Observing by itself is not enough, we employed specific recording techniques and metrics in order to obtain the highest quality data. All species of birds were counted the same, no birds were excluded from our data collection. The specific metrics counted during observations were total number of birds who stopped at the feeder, the counts of birds who arrived at the same time, and the time between the arrival of birds. For example say bird X bird shows or makes a vocalization then after t seconds bird Y shows up. The time t is recorded and if t is less than five seconds then the encounter is deemed as social eating behavior.
Observing Humans
In order to understand the social eating behaviors of 2 different species, data was collected from humans and birds. The humans observed in this study were students of Michigan State University. In order to minimize variation in this study, the humans were observed during the same time as the birds were. Since east neighborhood is the closest neighborhood to where the bird observations were done, the human observational studies were conducted at this location. Holmes cafeteria was used for the duration of this study. For four weeks, the human observational study took place twice on Sunday. It lasted for one hour from 11:00am to 12:00pm and 4:30pm to 5:30pm. Because of privacy concerns, no video observations were conducted. Using only the cafeteria and data collection notebooks, data was obtained. Only two tables were observed during each time period. This meaning that one table that initially only had one individual at the table and one table that initially had two or more people at the table were observed. Once the first individual or initial group sat down at the table, the time difference for another person to come to the table was recorded. Along with the time difference, the starting observational time, ending observational time, and other observations were recorded. Other observations included the amount of talking they did, if they used any electronic devices such as phones or computers while at the table, and how much food they consumed.
Data Analysis
In order to determine statistical significance we used a chi-square test of independence and a t-test. We used the t-test to determine the statistical significance of the number of birds that come to the undisturbed versus the disturbed feeder, we also use a t-test to determine the statistical significance of humans eating in groups versus eating in social groups. We used the chi-square test of independence to determine the statistical significance of the relationship between the number of birds at the feeder and social eating for birds. We also use the chi-square test to determine the statistical significance of the effect of the undisturbed and disturbed feeder on the response time. All tests were conducted using a probability value of 0.05 and one degree of freedom, a significant result of dependence from the chi squared test will be a chi squared value above 3.841. All statistical tests were conducted using the computation resource known as [vassar stats]. Error bars were necessary for a visual representation of statistical significance. We computed the standard deviation as the root of the mean square distance from the mean. Error bars for each plot were set as plus or minus one standard deviation. Correlation and statistical significance was our first step in determining the impact of vasopressin in the social behavior of birds.
PCR
Two DNA fragments were obtained and amplified by designing a qualitative polymerase chain reaction to detect the presence of the OXT gene. For the first step in this process, a primer for the human gene as well as a primer for the bird gene were needed. Primers are short DNA fragments with a defined sequence complementary to the target DNA that is to be detected and amplified (Garibyan, 2013). For the human pcr, primer pair 1 was used with a forward sequence CTTCGGCCCAATATCTGCT and a reverse sequence AAGAGGTGGAGTCAGGGGAA. For the bird pcr, primer pair 2 was used with a forward sequence GCTGCCAGGAGGAGAACTAC and reverse sequence TCTTCCGCGAGCAGATATT. For each polymerase chain reaction a solution was then made by combining .5mg of the target DNA template obtained from the bird feather for test 1 and human hair follicle for test 2, 5ml of 10xTBE solution, 50ml deionized water, 5ml of the forward primer, and 5ml of the reverse primer. The reaction solution was then heated above the melting point of the two complementary DNA strands of the target DNA, which allowed the strands to separate, a process called denaturation (Garibyan, 2013). The temperature was then lowered to allow the specific primers to bind to the target DNA segments, a process known as hybridization or annealing (Garibyan, 2013). Annealing between primers and the target DNA occurred only if they were complementary in sequence (e.g. A binding to G) (Garibyan, 2013). By examining the complementary sequences, comparisons between the human DNA and bird DNA were made and recorded.
Results
We counted the total number of birds that came in five minute intervals, over the course of each thirty minute observation. Table 1 displays the mean number of birds for each five minute interval. We found that every five minutes .997, or roughly one bird would come to the undisturbed feeder with a standard error of .131 (table 1). For the disturbed feeder we found that every five minutes 1.69 birds would come, with a standard error of .873. To determine statistical significance we conducted a t-test with p = .05 (Methods:Data Analysis for calculation details). We found that there was no statistically significant difference between the number of birds that came to each feeder.
In order to determine social eating in birds we used the metric of response time measured as the time between bird landings at the feeder, We deemed an event as social eating if the response time was less than five seconds. Figure 3 displays all recorded response times, additionally broken down into the number of birds at the feeder before the second bird arrives. As we can see from figure 3 a peak number of response times around three seconds, Table 2. gives the statistical significance of the dependence on response time and the number of birds at the feeder. We performed a chi-squared test of independence (Methods:Data Analysis for calculation details), we found that evaluating with p = .05 there was no statistical significance between social eating and the number of birds at the feeder. Performing the same chi-square test on the relationship between the undisturbed and disturbed feeder versus the response time. We found that there was no statistically significant influence on the response times from the choice of feeder (table 2).
We observed the average size of a human eating group in Holmes Hall cafeteria, shown in figure 4. We deemed a group as a social eating group if there was verbal communication throughout the group. We found that humans ate alone 31.4% of the time with a standard deviation of 5.11%. On the other hand, we found that 78% of the time humans would eat in a social group with a standard deviation of 19.46%. To determine statistical significance we performed a t-test, with p = .05 (Methods:Data Analysis for calculation details), we computed a p value of .0036. Thus there was a extremely statistically significant number of humans that ate in social groups rather than alone.
References
Gale, Bennett G and Laland, Kevin N. Social Learning in Animals: Empirical Studies and theoretical
models. Bio Science 55 (2005): 489-499.
Galef, Bennett G., and Luc-Alain Giraldeau. "Social influences on foraging in vertebrates: causal
mechanisms and adaptive functions." Animal behaviour 61.1 (2001): 3-15.
Garibyan, Lilit, and Nidhi Avashia. "Polymerase chain reaction." Journal of Investigative Dermatology 133.3
(2013).
Goodson, James. "Scientists Find a Common Link of Bird Flocks, Breast Milk and Trust." Indiana
University, 13 Aug. 2009. Web. 19 Oct. 2016.
Heinrichs, Markus, Bernadette von Dawans, and Gregor Domes. "Oxytocin, vasopressin, and human social
behavior." Frontiers in neuroendocrinology 30.4 (2009): 548-557.
Heyes, Cecilia. "What's Social about Social Learning?" Journal of Comparative Psychology 126.2 (2012):
193-202. ProQuest. Web. 19 Oct. 2016.
Israel, R, Lerer E, Shalev I, Uzefovsky F, Reibold M, Bachner-Melman R, Granot R, Bornstein G, Knafo A,
Yirmiya N, Ebstein RP. 2008. Molecular genetic studies of the arginine vasopressin 1a receptor
(AVPR1a) and the oxytocin receptor (OXTR) in human behaviour: from autism to altruism with some
notes in between. Elsevier 170: 435-436.
Kuenzel WJ, Kang SW, Jurkevich A. 2013. Neuroendocrine regulation of stress in birds with an emphasis on
vasotocin receptors (VTRs). Elsevier 190:18-19.
Marzlufi, John M., and Bernd Heinrich. "Foraging by Common Ravens in the Presence and Absence of
Territory Holders: An Experimental Analysis of Social Foraging." Animal Behaviour, vol. 42, no. 5,
1991. 755-770.
Patrick, Heather, and Theresa A. Nicklas. 2005. A review of family and social determinants of
children's eating patterns and diet quality. Journal of the American College of Nutrition 24.2:
83-92.
Slagsvold, T and K.L Wiebe. 2011. Social learning in birds and its role in shaping a foraging
niche. The Royal Society 366: 969-971.
Sridhar, Hari, Guy Beauchamp, and Kartik Shanker. Why do birds participate in mixed species foraging
flocks? A large-scale synthesis. Animal Behavior 78.2 (2009): 337-347.
Figures
Figure 1. Location of the disturbed (DBF) and undisturbed feeder (UBF) In relation to Holmes Hall. *Image made with the help of MSU interactive maps https://maps.msu.edu/interactive/
Figure 2. The disturbed bird feeder (DBF) used in the experiment. The DBF consisted of three hanging cages, four hanging cylinders and a house feeder on the top. The food found in the DBF was black oil sunflower seeds, sunflower hearts and chips, safflower and thistle.
Figure 3. Bird response time to another bird landing at the feeder, Also broken down into the number of birds at the feeder before the response bird lands. The undisturbed and disturbed bird feeder were observed in thirty minute periods outside of Holmes Hall at Michigan State University.The time measured was the time after a bird lands until another bird landed. If no bird arrived after twenty seconds, the timer was set to zero and started when a bird landed at the feeder. Data was gathered in six weeks (10/9 to 11/6) on Thursdays of each week 11:00am to 12:00 noon and 4:30 to 5:30pm, Each observation started by observing the disturbed feeder for the first thirty minutes.
Figure 4. Distribution of the average size of a Human eating group in Holmes Hall cafeteria. We obtained this data through observation of Holmes dining cafeteria of Michigan State University. We deemed a group socially eating if they communicated verbally while they ate. We averaged the relative percent of each group observed, n = 4. Data was gathered in six weeks (10/9 to 11/6) on Sundays 11:00am to 12:00 noon and 4:30 to 5:30pm. Error bars represent one standard deviation.
APPENDIX
Documentary
Link to Documentary