Oxytocin (OXT) and arginine vasopressin (AVP) are momentous genes studied in social neuroscience. Recent data suggests that OXT and AVP largely contribute to behavioral actions or responses under stressful situations through their physiologic roles in the central nervous system such as fluid homeostasis and blood pressure (Nephew, 2012). The purpose of this research is to seek homologous behaviour in midwestern birds and humans to auditory and visual cues of unfamiliar risks, while foraging. This homologous behavior is explained through the common gene these two organisms share: Oxytocin (OXT) and arginine vasopressin (AVP). It is hypothesized that humans and midwestern birds exhibit similar behavior with a shorter response time to auditory cues, in comparison to a longer response time to visual cues when presented with an unfamiliar risk, while foraging, due to increased spatial awareness. Midwestern birds were presented with playbacks of snake hissing and physical presence of artificial snake. Humans were presented with playbacks of cricket chirping and physical presence of artificial cricket. Response times were recorded while species were foraging. A visual reductionist approach was taken using a rope imitating the snake and a cricket leg in place of the full cricket. Humans and birds will exhibit similar behavior when presented to auditory and visual cues due to the OXT and AVP genes that are found in both species on chromosome 20. These homologous genes trigger a cue-specific response. Both species will have analogous responses to auditory cues, with a shorter response, and visual cues, with a longer response.

Written by: B-400

There is increasing evidence that many animal groups have the ability to balance risk of predation while foraging (Abrams 2019). Foraging is the process in which animals are directly feeding, hoarding, or provisioning food. Numerous species of animals including birds spend the majority of their time searching and eating food. In addition, birds often gather large quantities of food to save for later consumption, also known as hoarding (Smith and Reichman, 1984). The parent bird will also chew on the insect before feeding it to the offspring. This process of feeding other individuals is known as provisioning. Foraging is a key factor in evolutionary biology because it has a significant effect on the daily lives of a variety of species due to its impact on survival, growth, and predator avoidance (Kramer, 2001). Predation risk is a large factor in animals foraging behaviors since often times animals choose to forage in situations with minimal risk (Matassa et al., 2014), similarly humans exhibit foraging behaviors that keep them in the safest possible environment, since they also forage with the goal of predator avoidance. In addition, animals use various means of communication to relay messages between other members of the same species, it is most commonly used when animals warn others about a potential predators approaching (Vehrencamp et al.,2019). The relationship of humans and animals when both are foraging are related by sets of coevolved traits, which, in humans, are called the human adaptive complex (Kaplan et al., 2009). This similarity between foraging patterns of animals and humans, can be explained by the theory of evolution. Studies in this field help us gain a better understanding of the evolutionary mechanisms of animal groups (Kramer 2001).

Recent studies have shown the effects of predation risk on foraging behavior in free-living birds. Majority of the research performed, involving the foraging behavior of birds demonstrates the change in feeding patterns while at risk of predation. The research collected by Bonter and his colleagues was through observing bird-feeders and tracking birds by tagging them. This research demonstrated how birds forage around predation risks versus when there is no risk present (Bonter et al., 2013). One species of free-living birds that exhibit this behavior are the midwestern birds. The investigation will observe midwestern bird species in general rather than a specific type because it is more likely to find varying midwestern birds together compared to finding a specific species of midwestern bird. According to a recent study published by the University of Chicago Medical Center in Behavioral Ecology, it is common to find birds from different species cooperating to forage for food and defend territories together (University of Chicago Medical Center, 2018). A research conducted on the midwestern species showed that birds will forage around feeders that are lower in chance of being preyed on, which affects the location the species prefer to forage at, influencing the foraging behavior of the species (Grubb Jr et sl., 1997). Due to the substantial presence of Midwestern Birds at the Michigan State University Campus, attempting to segregate the midwestern birds and studying an individual type would lead to disorder, leaving gaps for error. Midwestern birds are popular in an urban setting, such as college campuses due to the placement of bird feeders in certain areas (McDonnel et al., 1997). Therefore, this results in the birds being more attracted to this setting due to the access to food by bird feeders (McDonnel et al., 1997). In addition to being in an urban setting, midwestern birds have a higher unfamiliarity to certain predators than rural birds due to the impact of urbanization. Midwestern birds are not as familiar with predation risks compared to how rural birds are since there is less exposure to certain risks in an urban setting (Vincze et al., 2016 ).

Since foraging is a key factor in the development of evolutionary mechanisms, as stated before, this means that there has to be genetic factors that control the different foraging behaviors in the birds, analogous to humans (Kramer 2001). Neuropeptides oxytocin (OXT) and arginine vasopressin (AVP) are two linked genes that play an important role in regulating complex social cognition and behavior (Heinriches et al., 2009; see also Benarroch, 2013). Receptors of OT and AVP in various regions of the brain are associated with the central nervous system, which controls stress and anxiety, and social behavior (Heinriches et al., 2009). Birds and humans were observed in order to come to a conclusion about the resemblance of the effect of OT and AVP genes in the foraging behavior of both subjects while at risk (Marshall et al., 2015; see also Slagsvold, and Wiebe, 2011). In order to quantify this data, the reaction time of birds and humans to their potential risks, based on the familiarity of the risk, were measured. A recent study suggested that urban sparrows have become more habituated to human disturbance, when compared to rural sparrows, which in turn suggests that urban birds have become unaccustomed to certain predators that are not common in urban settings (Vincze et al., 2016 ). The risk chosen for birds was the eastern hognose snake due to its presence in Michigan (Muzzall, 2005) while for humans, it was crickets due to their unfamiliarity of the risk and these were all tested by both visual and auditory signals. The unfamiliarity of the crickets in a cafeteria is due to the Environmental Protection Agency (EPA) top priority being the health of students, through mandating pest management in cafeterias. (EPA, 2017). In addition to the rubber snakes and artificial crickets as visual cues, a rope imitating a snake and an artificial cricket leg were used to approach methodological reduction. Using a reductionist approach will enable the analysis of complex methods by giving them a more simpler mechanism (Brigandt 2017).

We predict that there will be a significant difference between the response time recorded when the test subjects are presented with auditory and visual cues because these cues are perceived differently due to the central nervous system activity generated in response (Stein et al., 2009). OXT and AVP genes will have a significant effect on the foraging behavior of midwestern birds and humans due to the genes impact on the response time. This will occur because both of these genes influence risk taking abilities in a social context when taking into consideration the nature of the risk (Patel et al., 2014). Expected responses from birds to the cues presented could vary in actions such as flying away, looking around for threats, slower rate of foraging, and overall decrease in consumption. Similarly for humans, expected responses could range from running away, scanning their surroundings, discontinuation of foraging, slower rate of foraging, and analyzing (Bean et al., 2014; see also Hout et al., 2010). When taking the auditory and visual cues into consideration for birds and humans, we predict the auditory signals to be more reliable for both the species because these auditory signals increase their spatial awareness by evoking visual images of the potential source of sound (Kolarik, Moore et al., 2015; see also Suzuki, 2018). Therefore, we hypothesized that humans and birds show similarities, in response to an unfamiliar risk while foraging, by exhibiting a lower response to visual cues, in comparison to a higher response to auditory cues which in turn suggests that both birds and humans are more reliable on auditory signals. When using the reductionist approach to gain a better understanding of our results, we hypothesize that for the reductionist visual cues, the rope and the cricket leg , both the test subjects will have a longer response time due to their unfamiliarity with the predator which is contributed to their inability to differentiate between the reductionist visual cue versus the actual visual cue (Vincze et al., 20). Our null hypothesis for birds states there is no homologous behavior for visual reductionist cues and visual cues. Our alternative hypothesis states there is a homologous behavior in birds for visual reductionist cues and visual cues. The null and alternative hypotheses were the same for humans.

Written by: B-222

Over the course of four weeks, data was collected for this experiment. The midwestern birds were tested by using the artificial Heterodon (eastern hognose snake) species due to its presence in the midwestern area, specifically in Michigan (Muzzall, 2005). The baseline (control) trial included a normal environment, where there were no playback sounds of predators but solely just the natural environment of the Michigan State University campus. Maxine Whitefield studied behavioral ecology in sunbirds and their responses to visual cues but also stated the importance of auditory cues due to their guidance in helping identify food sources (Whitfield et al., 2014). Due to this, both visual and auditory cues are being investigated. In order to test other variables, the natural environment was manipulated to observe how the response mechanism of the midwestern birds would be affected with visuals of snakes without any sound and mobility, this was considered to be the visual trial. Research shows that birds often will react to visual cues when foraging which is why the investigation will conduct the visual trials (Whitfield et al., 2014). The auditory trial was conducted without any snakes physically present but with a playback of snake hissing (Ryan, 2012). Similarly, in the test with humans, there were both visual and auditory trials using crickets to produce a human response. Crickets were placed on a table in Holmes Hall Cafe additionally cricket chirping noises were played for the visual and auditory experiments. In addition to the auditory and visual trials, the investigation used the concept of reductionism in order to gain more credibility in the research by confirming that the trials will have similar results. The reductionist approach takes the overall theory or in the case of this investigation, our hypothesis, and tests whether the same results will be derived with a more minimalistic approach (Rosenburg, 2007). In conclusion, the visual versus auditory effects of unfamiliar predators in the experiment were observed, which was seen through the birds behavior, and whether the midwestern bird was familiar or unfamiliar with the predator.

The trials for observing the test subjects (humans and birds) were carried out over the course of a month. Researchers collected data four times a week for two hour periods on each day. Subjects were tested on different days and different times to incorporate randomization. Test subjects were observed when exposed to their potential risk (birds exposed to artificial rubber snake and rope while humans exposed to artificial cricket and cricket leg); this was performed under four conditions: baseline- normal campus environment, variable 1- visual cues of risk, variable 2- reductionist visual cues of risk, and variable 3- auditory cues of risk, in which 3 trials were performed for each variable. Throughout the experiment, researchers recorded foraging behavior by staying 15 feet away from the test subjects. For all variables, foraging behavior was recorded in a lab notebook and on an iPhone XR. The baseline variable was tested in humans and birds before testing the three variables. The test subjects were observed in their natural environment and the behavior was observed. Birds were attracted to bird feeders with the food present at the feeders behind Holmes Hall. To test variable 1, once birds were foraging at the bird feeder, an artificial eastern hognose snake was pulled in as a visual cue, with a rope, and placed 5 feet away from the bird feeder. To test variable 2, once birds were foraging at the bird feeder, a rope (4.5 feet) was pulled in as a reductionist visual cue. Finally, to test variable 3, 2 ultimate ears wonderboom mini bluetooth speaker (placed on both sides, 5 feet away from the bird feeders ) were used to play snake hissing auditory cues. Speakers were covered in leaves to keep the environment natural as possible. When observing humans, variable 1 was tested by placing an artificial cricket 5 feet away, on the ground, from the human. Variable 2 was tested by placing an artificial cricket wing 5 feet away, on the ground, from the subject. Finally variable 3 was tested using 2 ultimate ears wonderboom mini bluetooth speaker (placed 5 feet away, on the ground and on both sides of the table) to play cricket chirping sounds. The speakers were placed under the table to keep them out of sight of humans. For all variables, foraging behavior was recorded using an iPhone XR camera and response time, from the beginning of foraging to until the subject responds to the risk, was recorded.

For visual cues, two different chi-square tests were run. The first tested whether there was a significant statistical difference in response time in visual and auditory cues of birds. The second tested the same statistical difference in humans. With this, we can determine if the difference in responses is significant for humans and birds when they are tested with auditory and visual cues (McHugh). A t-test was used to investigate whether there was a significant difference between the average response time of birds to humans when using the visual cue. Another t-test was completed to determine if there was a significant difference between the average response time of birds to humans when using the auditory cue (Tae Kyu, 2015). In total, 4 statistical significance tests were run to analyze the data and determine if the data recorded was significant in terms of what was predicted. Response time for the visual experiment is defined as the time it takes for the organism to spot and react to the organism with associated risks; the response time for the audio experiment is defined as from the time the cue is played to when the organism exhibits any sort of response acknowledging the unfamiliar sound. After completion of the tests, a p-value is determined to conclude the significance; if the p-value is smaller than the base significance value (0.05), there is strong data supporting that there is a significant difference with the homologous behavior of the birds and humans.

Polymerase chain reaction (PCR) is a technique used to amplify segments of DNA. In this scenario, PCR will be utilized to investigate the presence of the AVP gene. A human and a bird primer are required to initiate the reaction where they will bind to both sides of the DNA that is being amplified. Primer pair 1 from humans, with a forward sequence of 5 prime-CTGAACTCCAGGAGCTGAG-3 prime and reverse sequence of 3 prime-TCTTCCGCGCAGCAGATATT-5 prime will be used (NCBI). These sequences were derived from basic local alignment search tool (BLAST). PCR for the DNA template strand requires 200 ul/pg of targeted DNA template, 200 mM of dNTP mix, 1x LB buffer, 50 ug/ml of water, 0.05 μg/ml of taq polymerase, 0.5 uM forward primer, 0.5 uM reverse primer, and 0.5 mM MgCl2(GenScript). The PCR products were formed by following the procedure published by Garibyan and Avashiya in a paper about the techniques for PCR and gel electrophoresis (Garibyan and Avashiya, 2014). The results derived from the PCR reaction were analyzed using the gel electrophoresis reaction to separate the DNA fragments based on their size. To prepare agarose gel, the required materials are agarose(1.5%), TBE buffer (45mM), and ethidium bromide (0.5 ug/ml) (EtBr) (Lee et al., 2012). Then, gel electrophoresis was performed using the methods published by Garibyan and Avashiya in a paper about the techniques for PCR and gel electrophoresis. The gel is stained by the DNA binding dye which produces bands that can be compared, leading to gene analysis in birds and humans (Garibyan and Avashiya, 2014).

Written by: B-007

Response time of birds and humans to predator encounters was recorded from the beginning of foraging to until the species respond to the auditory and visual cue presented. The average response times of birds to an artificial Eastern Hognose snake (visual cue) was 39.49 seconds and 51.38 seconds for humans presented with an artificial cricket (visual cue). It was predicted that visual cues will have a longer response time because the significance of visual cues is weak in situations where the visual predator recognition is restricted due to the unfamiliarity of the risk (MacLean and Bonter, 2013). The average response time of birds to a synthetic eastern hognose snake hissing (auditory cue) was 14.53 seconds and 13.42 seconds for humans presented with cricket chirping (auditory cue). It was predicted that auditory cues will have a shorter response time because of higher threat sensitivity to sensory stimulus such as auditory cues (MacLean and Bonter, 2013). Response times of birds and humans to any natural occurring cue in the environment was recorded as a control and it was calculated an average of 83.71 seconds for birds and 86.85 seconds for humans. In general, auditory cues evoked a lower response time than visual cues because these auditory signals increase spatial awareness by evoking images of the potential source of sound (Kolarik, et al., 2015; see also Suzuki, 2018). An independent t-test on auditory cues among humans and birds yielded a p-value of 0.0315, which proves that there is significant evidence to reject the null hypothesis, accepting the alternative, which means there exists a homologous behavior between birds and humans for auditory cues. Visual cues among humans and birds yielded a p-value of 0.4092, which accepts the null hypothesis that there is no homologous behavior among birds and humans for visual cues.

To further test homologous behaviors, a reductionist approach was followed and response time was recorded (Figure 2). The humans had a longer response time to the visual cue of the cricket leg. The average response time for humans was 107.11 seconds. The midwestern birds had a lower response time to the visual cues of the ropes with an average of 54.22 seconds. Humans react to insects in disgust (Lorenz et al., 2014), especially when in the cafeteria due to the health guidelines that Holmes Hall upholds. The insect poses as an unfamiliar risk to the environment which causes the response mechanism in humans. Due to humans possessing certain cognitive abilities, the data shows that they were able to distinguish between the artificial cricket and a real one which supports why the response was longer because they did not immediately react to the unfamiliar risk in the cafeteria (Ghirlanda et al., 2017). However, the birds reacted with a lower response time because they are urbanized and cannot recognize the difference between the ropes and snakes (Vincze et al., 2016 ). Due to this, they will react to the rope in the same manner as they would react to a snake. An independent t-test was conducted comparing visual cues and reductionist visual cues; a p-value of 0.451 was yielded for birds and a p-value of 9.81E-7 was yielded for humans. The p-value for birds suggests that there is a homologous behavior between visual reductionist cues and visual cues. Additionally, the p-value for humans suggests that there is no homologous behavior between visual reductionist cues and visual cues. For birds, these p-value does not provide statistically significant evidence so the null hypothesis, stating that there is no correlation among visual cues and reductionist visual cues, is accepted. This provides evidence that due to the reductionist visual cues not being actual predators, the response time was longer. This also further proves the homologous behavior among birds and humans since both species reacted similarly.

The types of behaviors exhibited by the birds and humans were categorized into four responses and they were all recorded (Figure 3). The auditory cues used were the synthetic cricket chirping and snake hissing. For the auditory and visual trials, the birds either flew away or stopped foraging to scan the area in 5 out of the 9 trials. The humans showcased a similar behaviour where 5 out of 9 times they scanned the area when exposed to a visual cue and 4 out of 9 times when exposed to an auditory cue, they left the site. This can be contributed to a predator escape tactic used by the birds since flight is one the most important escaping tactics from predators for birds (Hout, Mathot, Maas and Piersma, 2010). When comparing the behaviour of the birds and humans as they left the site when exposed to an auditory cue, it is relatively higher when exposed to a visual cue because both birds and humans rely more on the auditory cues since it is known to evoke a visual search image by triggering spatial awareness (Suzuki, 2018). Due to this spatial awareness, none of the birds approached the risk when exposed to a synthetic snake hissing because spatial awareness is the process of analysing the location of the potential predator; due to this without the exact location, the bird would be able to approach the risk (Suzuki, 2018). Overall, both birds and humans manifested the same behaviour when exposed to visual and auditory risks which we predict is due to the presence of OXT and AVP genes in both (Heinriches, Dawans et al., 2009).

To determine if the genes are present in both humans and birds, the gene specific primers of the AVP gene were found on the entire AVP genome sequence and the specific primers, from 5-3 prime, were tested (Figure 4a). OXT genes were not tested because the two being a linked gene, an assumption can be made that if AVP is common, OXT must be as well. Testing the forward and reverse primers in AVP gene on chromosome 20 from human genome sequence using PCR and gel electrophoresis yielded a predicted number of base pairs for humans on this chromosome. The target base pair segment for AVP was 337 bp, and a similar molecular weight is expected when running a human saliva sample through the gel electrophoresis (Figure 4b) (Bilbao 1999). If the target base pair was matched, there would be evidence that humans and birds share a common gene. Due to the lack of funding in the Biology Department at Lyman Briggs College, gel electrophoresis with the actual AVP primers was unable to be performed and compared to the expected base pair. To further the analysis of the OXT and AVP genes in the future, these primers could be acquired not only for the AVP genome in the human sequence, but also using the AVP genomes in the bird sequence, to test side by side on the gel if the DNA of birds and humans match to the expected base pair of 337 bp.

Written by: B-667

Figure 1: Response Time for Humans and Birds to the Presence of Predator Cues Depicting Longer Response Times from Visual cues than Auditory. Response time (seconds) of birds and humans to the visual and auditory cues of an unfamiliar predator were recorded above. Humans and birds were presented with a visual cue, an artificial cricket and artificial eastern hognose snake respectively, and an auditory cue, synthetic cricket chirping and synthetic snake hissing respectively. Response time was recorded based on the beginning of foraging to until the species responded to the risks presented. The control represents the natural response time from humans and birds when in their environment consisting of no cues. Additionally, an independent t-test was completed among auditory and visual cues for birds and humans to test the homologous behavior. The null hypothesis states that there is not homologous behavior among birds and humans for the type of cue tested. The alternative hypothesis states that there is homologous behavior among birds and humans for the type of cue tested. The p-values obtained for auditory: 0.0315 and visual: 0.4092.

Figure 2: Reductionist Approach for Visual Cues Proves Birds Response to Unfamiliar Risks is Consistent. The response times of birds and humans to a reductionist approach of the visual cues was recorded. Humans were presented with an artificial cricket wing as a reductionist version of a whole cricket, whereas birds were presented with a rope as an imitation of the snake. The reductionist approach of the visual cues were presented to humans and birds while they were foraging. Response time was recorded from the beginning of foraging to until the test subjects showed a response to the risk. Humans exhibited a longer response time, whereas birds exhibited a shorter response time.

Figure 3: Qualitative Behavioral Responses Portraying Leaving Site and Scanning the Area as Majority Responses The different types of behavioral responses are recorded. Each bar and color signifies the type of response that was observed from the birds and humans. There are a range of visual and auditory responses presented. For visual; leaving the site, approaching the risk, scanning the area, or having no response at all. For auditory; leaving the site, approaching the risk, scanning the area, or no response. The number of occurrences for each behavioral response were tracked and recorded. Both humans and birds exhibit similar number of except for actively leaving the site for the visual cue.

Figure 4: Forward and Reverse Primers in AVP Gene on Chromosome 20 from Human Genome Sequence and Predicted PCR/Gel Electrophoresis Test Results of Arginine Vasopressin Gene Exhibited Presence of a Common Gene In order to perform polymerase chain reaction (PCR), primers are required of the specific gene being tested, which is AVP in this case, to separate the DNA template. (A) Figure A displays part of the AVP gene sequence.Gene specific primers (5-3 prime), forward- GAGGAAGGGTCTGGAGTGGT and reverse- CATTGGCGGAGGTTTATTGTCC, (highlighted in red) were produced through Basic Local Alignment Search Tool (BLAST). (B) Figure B displays the predicted gel electrophoresis results. PCR products were separated through the process of gel electrophoresis. A 50 base pair ladder was produced with 2% agarose gel, which is a standard recommended percent of agarose for this specific ladder. Both humans and birds exhibited a similar molecular weight of 337 bp for the AVP gene, which evidence for the homologous gene (Bilbao 1999). (C) Figure C displays the results of the 2% agarose gel electrophoresis. 5 ul of the 100 bp gold DNA ladder was added to well 1 in order to estimate the size of the PCR product in the adjacent well.