Using PCR and Gel Electrophoresis to Amplify and Detect the DRD4 Gene in Human and Dog DNA

By: B105 and B265

Abstract

The human dopamine receptor D4 (DRD4) gene contains a 48 bp variable number tandem repeat (VNTR) in exon 3 on chromosome 11 (Campbell et al, 2010). This polymorphism has between 2 and 8-fold repeats which have been linked to individual differences in behavior (Inoue et al, 1993). In particular, the 7-repeat allele, which is very common in the population, has been associated with a strong sexual desire, arousal, and function (Halley et al, 2016). The purpose of this research study is to target and amplify the polymorphic section of the human DRD4 gene, linked with sexual behavior, and to design a PCR protocol to find the same, homologous, gene in dogs. We hypothesize that by modifying and carrying out a published DRD4 PCR protocol, amplification of the targeted polymorphic section of the human DRD4 gene will occur by successful site-specific binding of designed primers. Gel electrophoresis will allow for analysis of its base pair length to confirm successful amplification. Using the “Basic Local Alignment Search Tool” the number of base pairs in between the primers were calculated and thus we predict a band length of 395 base pairs. The forward primer, 5’ GCCCGCTCATGCTGCTGCTC 3’, is expected to anneal from base pair 7559 to base pair 7578 and that the reverse primer, 5’ CAGGAGGCGGCGTGCCAAGA 3’, is expected to anneal from base pair 7935 to base pair 7954 (Halley et al, 2016). By comparing DRD4 DNA of four organisms primers were designed to seek the same, homologous, gene in German Shepherd DNA using similar PCR and gel electrophoresis methods. The number of bases between the two designed primers is 230 base pairs giving our predicted base pair length of 230 bp for the section of dog DNA targeted by PCR methods.

Discussion

Experimental Purpose and Summary

Sexual behavior is an innate and paramount human behavior necessary for reproduction. This behavior has also been associated with health-related quality of life (HRQoL) in midlife women in particular (Thomas et al, 2014). Violent sexual incidents happen all too often in today’s society. Today, we punish offenders by locking them up and give little chance for improvement or reform (Erickson, 2012). Finding out how much of our behavior is coded for in our DNA versus how much is environmentally influenced and/or self controlled is important for investigating and improving such circumstances (Levitt, 2013). We believe analyzing the genetic information of the issue could perhaps prevent such frequent occurrence of these events because it will help us understand how a variety of endogenous chemicals, including hormones and neurotransmitters, influence elevated sexual behavior tendencies (Melis, 1995). The DRD4 gene is known to be highly polymorphic and in fact has been said to be one of the most polymorphic of all genes studied so far (Chen et al, 1999). Polymorphisms or different variations of the gene have suggested individual differences in human sexual desire and arousal as well as anger and impulsivity (Halley et al, 2016). Specifically, the 7-repeat allele in exon 3 has been associated with a strong sexual desire, arousal and function (Halley et al, 2016). We hypothesize that by modifying a published DRD4 PCR protocol, using site-specific designed primers, amplification of the targeted section of the DRD4 gene will occur. Gel electrophoresis will allow for analysis of its base pair length to confirm successful amplification. Following this procedure a PCR and gel electrophoresis protocol similar to that of the pervious was designed to amplify the same, homologous, gene in dogs. This is assumed to be present in canine DNA because the genomic sequence of several organisms have found to have a polymorphic region in the DR4D gene similar to that of humans (Miho et al, 2002).

Original Predictions

Human DNA was amplified, after being extracted from cheek epithelial cells, using primers expected to target part of the DRD4 gene. The length of the amplified DNA was then analyzed through gel electrophoresis to show whether or not the targeted region was successfully amplified. In experiment 1, using PCR to amplify a targeted region of the DRD4 gene in human DNA, the forward primer (Fprimer1), 5’ GCCCGCTCATGCTGCTGCTC 3’, was expected to anneal from base pair 7559 to base pair 7578 and the reverse primer (Rprimer1), 5’ CAGGAGGCGGCGTGCCAAGA 3’, was expected to anneal from base pair 7935 to base pair 7954. The number of base pairs in between 7559 and 7954 is 395 bp which is what was expected to show on a gel.

In experiment 2, using PCR to amplify a targeted region of the DRD4 gene in dog DNA, primers were designed by analyzing and comparing DRD4 DNA in 4 organisms. The primers that were created were Fprimer2 (forward) 5’ ATGGGGAACCGCAGC 3’ and Rprimer2 (reverse) 5’ CCAGGCTCACGATGA 3’. Successful annealing and subsequent extension during PCR is expected to produce a band length of 230 base pairs for this test. This is based on the loci where the primers would attach on the DNA of the four organisms analyzed in order to amplify the DRD4 gene.

Results and Ultimate Findings

Analysis of human DNA extraction using a photospectrometer and gel electrophoresis confirmed successful extraction from human cheek cells. The concentrations, determined by the photospectrometer, were 0.107 mg/mL, 0.087 mg/mL, and 0.113 mg/mL with an average of 0.102 mg/mL. The calculated mass of DNA in each of the tubes using their total volume were 43,014 ng, 34,104 ng, and 40,906 ng, respectively, with a combined total of 188,024 ng. In order to verify the presence of DNA, gel electrophoresis was done. We observed bright glowing wells where we placed a DNA and loading buffer cocktail, ensuring that human DNA was extracted. This was determined because the base pair length of the full genomic sequence would be too large to move through the agarose gel and would therefore not move out of the wells.

Lambda bacteriophage PCR cocktail was used as a positive control for the subsequent PCR  experiments on purified human DNA and dog DNA. Although the ladder was too condensed to create an accurate semi-log plot, a length of around 400 bp was assumed for the lambda DNA segments observed since the bands are about halfway down the bottom portion of the 1KB plus ladder. This result is consistent with what the expected base pair length was, and thus allowed us to use this experiment as a positive control. With further experimentation, new ladder concentrations would be used to confidently provide base pair length.

PCR was then carried out using the extracted human DNA and site-specific primers to target and amplify a polymorphic section of exon 3 of the DRD4 gene, and a 1680 bp band was observed in well 5. However, the expected length was calculated to be 395 bp so this result ultimately contradicts our hypotheses until further analysis of the base pairs of the amplified section using Sanger sequencing can be done. Long, non-specific bands can result from primers binding at the wrong temperature or not working due to an incorrect concentration in the PCR cocktail (Canene-Adams, 2013). With more time, more trials using a wider variety of annealing temperatures could increase the opportunity of successful annealing and subsequent amplification. In the second experiment on German Shepard DNA, no bands were observed from gel electrophoresis which means PCR was unsuccessful. One possible cause of failed PCR on our homologous organism DNA is choosing incorrect annealing temperatures, which would prevent our primers from binding or cause them to bind incorrectly, resulting in absence of products (Roux, 2009). The amount of DNA used could have also been an issue since 160 ng of high purity DNA were used, which is on the higher end of a published suggested range of 10 to 200 ng (Canene-Adams, 2013). With further experimentation, lower annealing temperatures along with several more trials using different amounts of DNA would be done to increase the likelihood of amplification.

Ladder    54.5°C     57.0°C     52.6°C   60.9°C

A.    1         2            3          4           5  

B.

Figure 4: Amplification of Human DRD4 Gene by PCR and Analysis by Gel Electrophoresis.

(A) After PCR amplification, gel electrophoresis was conducted in a 1% agarose TBE gel run at 115 volts for 15 minutes to detect amplified regions of human DNA. The PCR cocktail master mix contained 36µl of nuclease free water, 5µl of 10X PCR buffer, 1µl of Taq polymerase, 1µl of dNTPs, 5µl of human DNA template (500ng), and 1µl of each primer. This cocktail was split up into 4 microcentrifuge tubes with 12.5µl in each. The cocktails were run in the thermocycler at 95°C for an initial 3 minutes and then cycled between 30 seconds of 95°C, 30 seconds at the respective annealing temperature, and 1 minute at 72°C. The annealing temperatures were set on a gradient from 52.6°C to 60.9°C. The annealing temperatures are noted above each well. A 1% agarose gel was made by mixing 36 mL of deionized water, 4 mL of 10X TBE buffer, and 0.4 g of agarose powder in a beaker. After microwaving this solution in increments of 15 seconds, to prevent boiling, the beaker was allowed to cool. 2 µl of 20000x SYBR Safe dye was then added before being poured into a casting tray with a comb for well formation. The gel was then allowed to solidify. The gel was placed into the gel electrophoresis chamber and submerged in 1X TBE buffer. 4µl of deionized water was mixed with 1µl of 1KB Plus DNA Ladder and 1µl of Bromophenol blue loading dye and micro pipetted into well #1. 12µl of each PCR cocktail was mixed with 2µl of Bromophenol Blue loading dye and pipetted in wells #2-5. In lane 5 a band, indicated by the black box, shows amplification of DNA. (B)  A semi-log plot that measured migration distance of bands versus molecular size of 1KB Plus ladder was used to analyze the size of the band (bp) in well #5. The x-values represent the distance in centimeters that the bands of the ladder migrated away from the well and the y-values represent the size of those same bands in base pairs. A trend line was added in order to produce an equation for further analysis. This equation was used to calculate the human DNA PCR product in well #5. The base pair length in well #5, indicated by the black box, was calculated to be 1680 base pairs.