Genotypic Cloning of the UCP2 Human Gene and Identifying the Homolog in Black-Capped Chickadees Using PCR

By: A47938984, A47782151, A48365480, A48436094

LB 145 Cell and Molecular Biology

Monday/Wednesday 4 PM

Dr. Douglas Luckie, Ahmad Tahawi and Megan Kechner

2/16/15

www.msu.edu/~greath11

(Title page written by: A47938984)

(Title page revised by: A48436094)

(Title page finalized by: A48365480)

Abstract

Written By: A47938984

Revised By: A48436094

Finalized By: A48365480

The UCP2 human gene, associated with type 2 Diabetes, plays a crucial role in fat metabolism and in energy homeostasis in mammals (Mozo et al, 2005). Previous research has supported the hypothesis that fat metabolism plays a crucial role in the ability of avian species to store fat (Neuman et al, 2002). For this reason, our goal was to look at fat metabolism and energy homeostasis at both an organismal and molecular level in humans and black-capped chickadees.  The purpose of the experiment was to amplify the UCP2 gene using polymerase chain reaction (PCR) and published primers and then design PCR primers to identify a homolog in black-capped chickadees. We hypothesized that we would amplify the targeted region of the UCP2 gene producing an 101 base pair product and its genetic homolog in black-capped chickadees can be identified at 479 base pairs due to previous PCR analytic research (Yu et al, 2005). PCR was used to amplify the UCP2 gene using specific annealing primers. The DNA product was analyzed through gel electrophoresis to visualize and confirm the successful cloning of UCP2. Bands were present at 101 base pairs at 63℃, 61.8℃, 59.9℃, 57.1℃, and 53.7℃. A homolog in the black-capped chickadee was not identified. By studying the UCP2 gene and its genetic homolog, we can gain a better understanding of fat metabolism in humans and avian species.

Introduction

Written By: A47938984

Revised By: A48436094

Finalized By: A48365480

Exploration of the UCP2 gene, associated with type 2 diabetes, in greater depth through polymerase chain reaction (PCR) will result in an increased understanding of fat metabolism and in energy homeostasis of mammals by also finding the homolog of this gene in black-capped chickadees. By obtaining previously published primers and methods used to perform PCR of the UCP2 uncoupling protein gene, we predicted that we would successfully clone the disease causing the gene and find the genetic homolog in black-capped chickadees because of previous analytic PCR research in which the UCP2 gene was cloned using PCR (Yu et al, 2005).

The UCP2 gene is located on chromosome 11 and consists of 2113 nucleotides. This codes for an amino acid sequence 309 amino acids long (Yu et al, 2005). The UCP2 gene codes for an uncoupling protein that functions as a proton transporter in the inner mitochondrial membrane. Normally, the uncoupling protein transports protons into the mitochondrial matrix (Rousset et al, 2015). An additional type of proton transporter lies within the inner membrane, fueled by the electron transport chain it moves protons into the mitochondrial matrix which synthesizes ATP (Schrauwen and Hesselink, 2002). The UCP2 gene diminishes the proton gradient between the intermembrane space and the mitochondrial matrix, decreasing the rate that protons are transported into the matrix and ATP produced from their transport (Rousset et al, 2015). UCP2 decreases the amount of ATP and ROS (reactive oxidative species) produced and allows for some of the chemical energy to be released as heat. If ROS is allowed to reach too high of a level, it can damage other cells in the body (Rousset et al, 2015).

PCR is a method used by scientists to copy a specific target region of DNA and amplify it inside of a solution (Simon et al,1991). Once the desired region is amplified it is subject to further analysis. To visualize the product containing the amplified region of DNA, it is poured into a gel that maintains an electric current. Different strand sizes travel through the porous gel at different rates, causing the resulting gel to have a series of bands with varying levels of brightness. To run a PCR experiment, a reaction cocktail requiring a salt solution with the proper concentration and PH, also known as buffer, is exposed to numerous temperatures for a set amount of time at each temperature. These temperatures were run for a set number of cycles until the DNA is amplified and is the majority of the solution. Individual nucleotides are required to build onto the primer sequences after the polymerase anneals and it’s activated. Two primers, composed of short nucleotide sequences, are needed to anneal to the DNA template and start initial replication. Taq polymerase is also essential to run the PCR because it is equipped to withstand high temperatures and carries out the enzymic reaction (Simon et al, 1991). The primers we use, along with their corresponding denaturing and annealing temperatures, come from published studies (Yu et al, 2005). After the completion of PCR, proceeded to run the amplified product through a gel to visualize the UCP2 gene. We hypothesized that the UCP2 gene could be copied because there would be an 101 base pair long amplified region corresponding to the UCP2 gene sequence on the gel after electrophoresis (Yu et al, 2005).

Uncoupling proteins, a member of the mitochondrial anion protein family, play a large part in the fat metabolism and energy homeostasis of avian species. The UCP2 gene, specifically, aids in the regulation of energy and fat storage. By studying the food preference of avian species and cloning the UCP2 gene, if we found the homolog in black-capped chickadees it is possible to gain a better understanding of metabolism and energy homeostasis in both humans and avian species at the molecular level, now that we are able to understand it in avian species at the organismal level.

In our study, we predicted that an 101 base pair product will be amplified based on published methods and primers (Yu et al, 2005). We also plan to find a homolog of the UCP2 gene in black-capped chickadees. We predicted this product should be about 479 base pairs long based on where the published primers from our UPC2 gene best fits with the PTCH gene found in black-capped chickadees which may be similar to the UCP2 gene in function (Mozo et al, 2005). The amplification of the 101 base pair region of the UCP2 gene was successful.

Methods

Written By: 48365480

Revised By: 47782151

Finalized By: 48436094

PCR

For our PCR, the UCP2 gene was cloned, resulting  in a 101 base pairs long product located on codon 55 of exon 4 (Yu et al, 2005). Its forward primer anneals from base pair 956 to 978 and its reverse anneals from base pair 1036 to 1056, forming a 101 base pair product. Our reaction cocktail was 100 µl in total and contained 3.5 µl of the forward primer (5’- TTGCAGATCCAAGGAGAAAGTCA-3’) and 3.5 µl of the reverse primer ( 5’- CCCTCAGTACGCACCATGGT-3). The primers were ordered from Integrated DNA Technologies (IDT). The reaction also contained 72 μl of water, 10 μl of 10X PCR buffer, 3 μl of magnesium sulfate, 2 μl 10mM dNTPs, 5 μl DNA template, and 1 μl of Taq polymerase. After the reaction cocktail was made, it was initially heated to 95℃ for 30 seconds, later at 51.2-52.9 ℃ for 30 seconds, and lastly at 72℃ for 1 minute. This entire cycle denatured the DNA one time. The reaction cocktail was required to undergo a total of 35 cycles. To test the PCR products for content, they were run through an agarose gel electrophoresis. The 1% agarose gel was made by first measuring out 0.4g agarose powder and mixing that with 2 ml 20x LB buffer and 38 mL of water. The solution was then microwaved for 1 minute and 30 seconds until the agarose solution was completely dissolved and the solution was at a rolling boil. The solution was then cooled for a few minutes by running water over the flask. Following the addition of 1 µl 10 mg/ml of GloGreen, the solution was poured into a gel tray with a well comb already inserted. The gel was then poured and left to sit, allowing it to become slightly firm. After this process, the wells in the gel were filled with 6 µl of PCR product and 3 µl of loading dye. The amplification of the products in the gel were analyzed by trans illumination with ultraviolet light. We were able to observe any bands that appeared and if there were, we created a semi-log plot to confirm the location of the bands. Pictures of the gel were taken and saved for later observation and comparison.  

Lambda acted as our control experiment. Not only did bands appear as expected, they appeared at the correct base pairs. When performing our experiment using human DNA, the same ingredients and amounts were put into the reaction cocktail. The only difference was the type of DNA and primers, though they were in the same amounts.  As a negative control, we ran a cocktail lacking any DNA through gel electrophoresis. Had any bands appeared, we would know that the annealing of primers to one another was taking place. This would cause us to be less confident that our bands were being created purely by DNA.

Results

Written by: 47782151

Revised by: 48365480

Finalized by: 47938984    

In this experiment, human DNA was used as the template for the PCR. The PCR amplified a targeted region on the DNA segment. In this study, a 101 base pair product on the UCP2 gene was the targeted region in the PCR experiment. Before running PCR pure DNA was isolated using the Capture Column Kit and ran through gel electrophoresis to ensure its purity. The purified DNA had 1.935 absorbance ratio of DNA to proteins (Figure 1a). The purified DNA was then run through gel electrophoresis where its purity was confirmed because the DNA was too large to travel down the well (Figure 1b). In order to create the PCR protocol for the amplification of the UCP2 gene, we first created a protocol that successfully amplified the lambda virus. Previous PCR was attempted with E.coli, but was unsuccessful in producing bands (Figure 2).  The 500 base pair target region of the lambda virus was amplified using the following protocol: 30 seconds at 95℃ for denaturation, 30 seconds at the 51.2℃ for annealing, and 1 minute at 72℃ for elongation for 35 cycles (Figure 3a and 3b). In the attempt to get clearer bands with the UCP2 gene the protocol was changed slightly by increasing the amounts of each primer by 1 µl, and running the gel at 125 voltage for 40 minutes. This protocol was used on the UCP2 gene because the same amounts of DNA were used with lambda with identical concentrations. The annealing temperature was modified to a higher gradient because of the primers for UCP2 and lambda are different. The published primers previously used for UCP2, (5’-GATGTATGAGCAGAGTCACCGCGAT-3’) and (5’-GAGGGTGAAATAATCCCGTTCAG-3’), were used to anneal to the designated region on the UCP2 gene (Figure 4). The forward primer annealed at base pair 956 to 978 and the reverse primer annealed at base pair 1036 to 1056 (Yu et al, 2005). The amplified 101 base pair PCR product was viewed using agarose gel electrophoresis with a lithium borate buffer system (Figure 5). Gel electrophoresis was also used to test the UCP2 negative control. No bands were produced in the lane containing the negative control version of the DNA cocktail, which is what we expected because no DNA was present in the cocktail (Figure 6).  As a second part of the experiment, PCR primers were designed to anneal to a homolog in a black-capped chickadee. In In future experiments with gel electrophoresis using a LB buffer system, the PCR products will be amplified.

Discussion

Written By:48436094

Revised By:47938984

Finalized By: 47782151

Original Predictions

Uncoupling proteins (UCP) play a crucial role in the fat metabolism and energy homeostasis of mammals and avian species (Mozo et al, 2005). Previous research has suggested that a mutation of the UCP gene correlates to type 2 diabetes (Yu et al, 2005). These proteins are part of the mitochondrial anion carrier protein family, and when in a functional state, diminish the proton gradient across the inner mitochondrial membrane (Stuart et al, 1999). The UCP2 gene is one of many humans’ genes that are important for regulating energy and fat storage (Yu et al, 2005).This year long experiment examines fat metabolism and energy homeostasis on both an organismal and molecular level.  The first part to this year long project involved studying the food preference of avian species and the second part of the experiment looked at the fat metabolism through a molecular level by examining the UCP2 gene. By examining fat metabolism and energy homeostasis at an organismal and molecular level it will help scientists better understand the role of genes in these essential functions for life in humans and other species (Mozo et al, 2005).

Previous research from our study examined, from an organismal standpoint, the feeding patterns of black-capped chickadees and its association with fat content (Bednekoff and Houston, 1994; Rodgers and Reed, 2003). It was shown in this first experiment that when offered the choice of a high-fat suet and a low-fat suet, birds have a greater preference for the high-fat suet because it increases their overall fat storage, giving them a greater likelihood of surviving the winter months when resources are depleted.

The second phase approaches our overall question from a molecular level. We hypothesized that we would amplify the targeted region of the UCP2 gene producing an 101 base pair product and its genetic homolog in black-capped chickadees can be identified at 479 base pairs due to previous PCR analytic research. The UCP2 gene in human’s codes for a proton transporter embedded in the inner membrane of the mitochondria (Schrauwen and Hesselink, 2002). The gene is 2113 nucleotides long and located at chromosome 11. This protein creates a proton leak, hence leaking protons into the mitochondrial matrix. The extra pathway for protons into the matrix diminishes the proton gradient between the mitochondrial matrix and the intermembrane space. Diminishing the gradient reduces the rate protons are brought into the matrix, therefore also decreasing the production of ATP which the excess energy is given off as heat (thermogenesis) instead of stored as fat (Mozo et al, 2005).

Ultimate Findings

To ensure a successful product the positive control, the lambda PCR protocol, and the negative control, reaction cocktail without the DNA, was run to ensure that our UCP2 band was at the correct base pair in the gel.  In order to discover a successful lambda PCR protocol, the DNA concentrations, primer concentrations, buffer solutions and annealing temperatures were altered during many experimental trials until the correct base pair product appeared in the gel. The lambda PCR protocol, using lambda primers and lambda DNA, produced a base pair product at 514 base pairs at the annealing temperature of 51.2℃ (Figure 3). Since the band was expected to appear around 500 base pairs long it was concluded that the lambda PCR protocol was an accurate procedure to produce bands. This experimental method was replicated by using the exact PCR cocktail ingredients except human DNA and the published primers were used in replace of the lambda DNA and lambda primers. As a negative control, no Taq polymerase was added to the UCP2 cocktail in order to ensure no bands would appear on the gel indicating there was no nonspecific annealing. As expected, no bands appeared in the gel (Figure 6).

Materials, including forward and reverse primers from a published primer, and PCR protocol from our positive control study was used to clone the human wild-type UCP2 gene and gel electrophoresis was used to interpret our results (Yu et al, 2005). The UCP2 gene was successfully cloned because the 3 end of the forward primer annealed to 978th nucleotide of the base pair sequence, the 3 end of the reverse primer annealed to the 1037th nucleotide, thus creating an 101 bp long band amplified in the gel at the annealing temperature of 50.9-63℃ (Yu et al, 2005) (Figure 5). The 101 base pair product supported our hypothesis that a 101 base pair product of the UCP2 gene would be amplified using PCR analytic research.

Future Directions

The specific role of UCP in avian species currently cannot be pinpointed (Mozo et al, 2005). Different studies have attempted to sequence the UCP genetic homolog of avian species in chickens in the hopes to better understand the function of avian species (Evock-Clover, 2002).  The presence of mitochondria in avians suggests there may be some form of UCP in the mitochondria that carries out a similar function to allow energy expenditure and fat metabolism to be regulated properly, as seen in humans. One study from previous literature conducted a PCR and northern blot analysis of chicken avUCP cDNA with outcomes that supported the claim avUCP’s play a role in energy expenditure (Raimbault et al, 2001). The specific presence of the UCP homolog in the skeletal muscle of birds, along with the up-regulation after cold acclimation are results that can help start to explain its relationship to thermogenesis ( (Raimbault et al, 2001).  

As a future project we will create a new protocol to identify the UCP2 gene in its homolog in the black-capped chickadee using our successful UCP2 primers as a template for new ones or create primers based on conserved regions of the black-capped chickadee DNA. Since we successfully cloned the UCP2 gene from the positive PCR method, we will start by using the same positive PCR method as a template for the homolog. Depending on the results from the first experimental trial, we will alter the procedure until the excepted 479 base pair product appears in the gel. From both an ecological and evolutionary standpoint avian species and humans have many differences. At the evolution level avian species UCP’s and human UCP’s are separated by generations of other animals, each with a different variation of UCPS. Between these two species evolutionary periods the UCPS of humans evolved from UCP1, stemming from UCP2, further back to UCP3, and then avian UCP’s. As organisms evolve, certain genes can disappear if they are not needed any longer to reproduce and survive (Mozo et al, 2005). The two species also have different living and eating patterns and movement capabilities (Newman et al, 2002). Avian species can move with the weather, making thermogenesis more situational than essential when compared to the sedentary lifestyle of humans (Rodgers and Reed, 2003).

One step we will take in the homolog study is to compare the human UCP2 gene to a more similar animal’s genome. From there it is predicted by comparing the human gene to increasingly dissimilar species genomes and aligning the matches alongside one another we can identify the similar base pairs in the chickadee genome as well as if the alike sequences are significant. Searching for alike sequences between the human UCP2 gene and the mitochondrial DNA of the chickadee could result in important similarities. The mitochondria make their own DNA and because the UCPS genes are mitochondrial proteins, it is possible it could be synthesized in the mitochondria and not the nucleus.

Cloning the UCP2 gene in humans and further applying this data to contribute to the design of a new PCR protocol to clone its homolog in black-capped chickadees helps answer many scientific questions, specifically those referring to the genetic component of an organism’s metabolic state. This genetic data coupled with the feeding tendencies and fat content of an avian species diet give scientists a well-rounded understanding from both the molecular and organismal level. Further research could use this model of experimentation on various other types of birds to compare the expression of the UCP homolog in the DNA to feeding patterns, movement capability, and nutritional intake.

References

Written By:48436094

Revised By:47938984

Finalized by: 47782151

Ahsen, N. V., C.T Wittwer, and E. Schütz. 2001. Oligonucleotide Melting Temperatures under PCR Conditions: Nearest-Neighbor Corrections for Mg2+, Deoxynucleotide Triphosphate, and Dimethyl Sulfoxide Concentrations with Comparison to Alternative Empirical Formulas. Clinical Chemistry 47: 1956-1961.

Bednekoff, P. A. and A. I. Houston. 1994. Avian daily foraging patterns: effects of digestive constraints and variability. Evolutionary Ecology 8: 36-52.

Evock-Clover, C. M., S. M. Poch, M. P. Richards, C. M. Ashwell, J. P. McMurtry. 2002. Expression of an uncoupling protein gene homolog in chickens. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology 133(2): 345-358.

Mozo, J., Y. Emre,  F. Bouillaud, D. Ricquier, and F. Criscuolo. 2005. Thermoregulation: what role for UCPs in mammals and birds? Bioscience Reports 25(3,4): 227-249.

Newman, R.E., W.L. Bryden, E. Fleck, J.R. Ashes, W.A. Buttemer, L.H. Storlien, and J.A. Downing. 2002. Dietary n-3 and n-6 fatty acids alter avian metabolism: metabolism and abdominal fat deposition. British Journal of Nutrition 88: 11-18.

Raimbault, S., S. I. Dridi, F. Denjean, J. Lachuer, E. Couplain, F. Bouillaud, A. Bordas, C. Duchamp, M. Taouis, and D. Ricquier. 2001. An uncoupling protein homologue putatively involved in facultative muscle thermogenesis in birds. Biochemistry 353: 441-444.

Riedy,M.F., W.J.Hamilton, and C.F.Aquadro. 1992.Excess of non-parental bands in offspring from known primate pedigrees assayed using RAPD PCR. Nucleic Acids Research 20: 918

Rogers, C.M. and A.K. Reed. 2003. Does avian fat storage integrate temperature and resource conditions: A long term study. Journal of Avian Biology 34: 112-118.

Rousset, S., M.C. Alves-Guerra, J. Mozo, B. Miroux, A.M Cassard-Doulcier, F. Bouillaud, and D. Ricquier. 2004. The Biology of Mitochondrial Uncoupling Proteins. American Diabetes Association 130-135.

Schrauwen, P. and M. Hesselink. 2002. UCP2 and UCP3 in Muscle Controlling Body Metabolism. The Journal of Experimental Biology 205: 2275-2285

Simon, C., A. Franke, A. Martin. 1991. The polymerase chain reaction: DNA extraction and amplification. Molecular Techniques in Taxonomy 57: 329-355.

Sommer, R. and D Tautz. 1989. Minimal homology requirements for PCR primers. Nucleic Acids Research 17: 6749.

Stuart, J. A., K. M. Brindle, J. A. Harper, and M. D. Brand. 1999. Mitochondrial proton leak and the uncoupling proteins. Journal of Bioenergetics and Biomembranes 31(5): 517-525.

Yu, X., D.R. Jacobs Jr, P. J. Schreiner, M. D. Gross, M. W. Steffes, and M. Fornage. 2005. The uncoupling protein 2 Ala55Val polymorphism is associated with diabetes mellitus: the CARDIA study. Clinical Chemistry 51 (8): 1451-1456.

Figures

Written by: 47782151    

Revised by: 48365480

Finalized by: 47938984 1a.) 1b.)

Figure 1a and 1b: Extraction and gel electrophoresis of DNA from cultured cells. (A) The actual absorbance ratio of DNA to proteins was 1.935, which is close to the ideal number 1.8. DNA that is considered to be pure usually generates a value between 1.4 and 1.9. Having a higher value is indicative of more material than just DNA in the cells. The dsDNA absorbs at 260 nm, which is why the absorbance is set at 260/280. This ratio is most effective in assessing the purity of DNA. (B) Upon receiving cultured cells, we were able to extract the DNA through the use of a Capture Column Kit comprised of a Capture Column, DNA Collection Tube, two Waste Collection Tubes, and both a DNA Purification Solution and DNA Elution Solution. To begin, a 200 µl sample of the cells was added to the Capture Column through a pipet. After incubation for 1 minute at room temperature, 400 µl of DNA Purification Solution was added and then the Capture Column was centrifuged for 15 seconds at 2.4 rpm. 600 µl of waste was added to one of the Waste Collection Tubes and the Column Capture was transferred to the second Waste Collection Tube, along with 400 µl of DNA Purification Solution. After another brief period of incubation, the cells went through the same process of being centrifuged and 200 µl of DNA Elution Solution was added. Centrifuging occurred once again, followed by transferal of the Capture Column to the DNA Collection Tube. After adding 100 µl DNA Elution Solution and incubation at 99˚ for 10 min, it was centrifuged for the last time. Unlike before, it occurred for 30 seconds, but kept the same rpm of 2.4. After this final step, the DNA was ready for analysis. To test whether the DNA extracted was indeed pure it was run through gel electrophoresis. In well one, a 9 µl increment of liquid comprised of 6 µl of 1 Kb Plus DNA ladder and 3 µl of loading dye was pipetted into the well. In well two, 3 µl of loading dye along with 6 µl of purified DNA was pipetted into the well. The gel ran on 115v for 35 minutes. Heating a mixture of 2mL of LB buffer and 38 mL of water in a microwave for 1 minute and 30 seconds made the 1% agarose gel. The solution was cooled by being placed under cool water. 1µl of Glo-green fluorescent dye was added to the gel. This gel proves the DNA that was extracted was pure because well two shows the DNA initially trying to leave the well, but because of DNA’s size it could not travel very far on the gel

Figure 2: Amplification of E.coli gene by PCR and gel electrophoresis. The targeted region of the gene was approximately 522 base pairs long. Two primers were used in order to amplify the targeted region: 8F and 529R. The PCR cocktail contained 10µl of the PCR buffer without MgCl, 2µl of dntp’s, 3µl of Mg sulfate, 2.5µl of each primer, 0.5µl e.coli, 1µl Taq polymerase and 78.5µl of water. The PCR cocktail was run in the thermocycler for 30 seconds at 95℃ for denaturation, 30 seconds at the annealing temperature for annealing and 30 seconds at 72℃ for elongation. The annealing temperature had a gradient from 53-57℃. The first well’s annealing temperature was 53℃, the second was 53.3℃, then 53.8℃, then 54.6℃, then 55.5℃, then 56.2℃, then 56.7℃ and lastly, well 8 was at 57℃. 6µl of the PCR cocktail was mixed with 3µl of the bromophenol blue dye. The PCR product was placed in a gel. The 1% agarose gel was made by combining 0.4g of agarose powder with 40mL of diluted 1xLB buffer. The 1xLB buffer was diluted by using 2mL of the LB buffer with 38mL of water. The solution was placed in a microwave for 1 minute and 30 seconds until the solution was completely dissolved and at a rolling boil. The solution was cooled by being placed under cool water. 1µl of Glo-green fluorescent dye was added to the gel. The 9µl PCR product with dye was placed into each well. The first and last well contained 6µl of 1kb Plus ladder with 3µl of the bromophenol blue dye. The gel was run for 35 minutes at a voltage of 115. After the gel was run, the PCR products were analyzed under ultraviolet light in order to see the bands of the targeted region. This trial of gel electrophoresis yielded no amplified bands of DNA.

6b.)

Figure 3a and 3b: Amplification of Lambda gene by PCR and gel electrophoresis. (A) The targeted region of the gene was approximately 500 base pairs long. Two primers were used in order to amplify the targeted region: 1Rz1F and 1-Rz 1R. The PCR cocktail contained 10µl of the PCR buffer without MgCl, 2µl of dntp’s, 3µl of Mg sulfate, 2.5µl of each primer, 5µl lambda, 1µl Taq polymerase and 74µl of water. The PCR cocktail was run in the thermocycler for 30 seconds at 95℃ for denaturation, 30 seconds at the annealing temperature for annealing and 1 minute at 72℃ for elongation. The annealing temperature had a gradient from 45-51.2℃. Wells one and two annealing temperature was ran at 51.2℃, the second and third at 52.9℃, and the third fourth wells at 45℃. 6µl of the PCR cocktail was mixed with 3µl of the bromophenol blue dye. The PCR product was placed in a gel. The 1% agarose gel was made by combining 0.4g of agarose powder with 40mL of diluted 1xLB buffer. The 1xLB buffer was diluted by using 2mL of the LB buffer with 38mL of water. The solution was placed in a microwave for 1 minute and 30 seconds until the solution was completely dissolved and at a rolling boil. The solution was cooled by being placed under cool water. 1µl of Glo-green fluorescent dye was added to the gel. The 9µl PCR product with dye was placed into each well. The two kb ladder wells contained 6µl of 1kb Plus ladder with 3µl of the bromophenol blue dye. The gel was run for 35 minutes at a 115 voltage. After the gel was run, the PCR products were analyzed under ultraviolet light in order to see the bands of the targeted region. In this gel there was successful amplification of the region 500 base pair region highlighted in the red box. (B) A semi-log plot was used to confirm successful amplification by using the formula y=892.87x^-1.259. The graph is showing the molecular base pair size as the bands travel farther and farther from the start of the well. As the distance from the well increases, the molecular base pair product decreases in size because it becomes harder for the larger products to travel through the gel but still allowing the smaller products to move.

Figure 4: Annealing of published primers with UCP2 genetic sequence. Representation of PCR annealing using wild type UCP2 DNA and published primers. Before the annealing stage, the hydrogen bonds connecting the sense and antisense strands were broken at 95 degrees Celsius. The figure shows the forward primer, 5’TTGCAGATCCAAGGAGAAAGTCA3’, and reverse primer, 5’CCCTCAGTACGCACCATGGT3’, annealing to the ends of the desired 101 bp DNA region at 62℃. The complementary base of adenine (A) is Thymine (T), and the complementary base of guanine (G) is cytosine (C). The nucleotide bases of the forward primer form hydrogen bonds with their complementary bases on the antisense strand of the DNA target region. The nucleotide bases of the reverse primer form hydrogen bonds with their complementary bases on the sense strand of the DNA target region. There is only one base on the reverse primer that does not match up with the complementary base on the template strand. As shown by the “x” in the figure, the cytosine on the 5’ end of the reverse primer will not anneal to the adenine on the 3’ end of the template strand. This should not affect amplification because matches toward the 3’ prime end of the primers are more essential for the Taq Polymerase to bind to the correct region to begin amplification.

5a.) 5b.)

Figure 5a and 5b: Amplification of UCP2 gene by PCR and gel electrophoresis. (A) The targeted region of the gene was approximately 101 base pairs long. Two primers were used in order to amplify the targeted region: 5’TTGCAGATCCAAGGAGAAAGTCA3’F forward primer and 5’CCCTCAGTACGCACCATGGT3’R reverse primer. The PCR cocktail contained 10µl of the PCR buffer without MgCl, 2µl of dntp’s, 3µl of Mg sulfate, 3.5µl of each primer, 5µl purified human DNA, 1µl Taq polymerase and 72µl of water. The PCR cocktail was run in the thermocycler for 45 seconds at 95℃ for denaturation, 45 seconds at the annealing temperature for annealing and 1 minute at 72℃ for elongation. The annealing temperature had a gradient from 50.9-63℃. 6µl of the PCR cocktail was mixed with 3µl of the orange loading dye. The PCR product was placed in a gel. The 1% agarose gel was made by combining 0.4g of agarose powder with 40mL of diluted 1xLB buffer. The 1xLB buffer was diluted by combining 2mL of the LB buffer with 38mL of water. The solution was placed in a microwave for 1 minute and 30 seconds until the solution was completely dissolved and at a rolling boil. The solution was cooled by being placed under cool water. 1µl of Glo-green fluorescent dye was added to the gel. The 9µl PCR product with dye was placed into each well. Wells one and fourteen contained 6µl of 1kb Plus ladder with 3µl of the orange loading dye. The gel was run for 40 minutes at a 125 voltage. After the gel was run, the PCR products were analyzed under ultraviolet light in order to see the bands of the targeted region. In this gel there was successful amplification of the region 101 base pair region highlighted in the red box. Successful amplification was observed across all wells in the gel. (B) A semi-log plot was used to confirm successful amplification by using the formula y=1375x^-1.215. The graph is showing the molecular base pair size as the bands travel farther and farther from the start of the well. As the distance from the well increases, the molecular base pair product decreases in size because it becomes harder for the larger products to travel through the gel but still allowing the smaller products to move.

Figure 6: Negative Control of UCP2 gene amplification. The 1% agarose gel used in this negative control trial was made by diluting 2 mL of LB buffer with 38 mL of water and microwaving the mixture for 1 minute and 30 seconds. After the mixture had cooled 1 µl of Glo-green florescent dye was added to the solution. The solution was then poured into a gel tray where it soon solidified. The two kb ladder wells contained 6µl of 1kb Plus ladder with 3µl of the bromophenol blue dye. The negative control (NC) lane contained 3 µl of the bromophenol blue dye and 6 µl of the same UCP2 PCR cocktail used in figure 5a without adding DNA. The purpose of this test was to show that our amplification protocol was successful and no primer dimers occurred because there are no bands in the NC lane, as we expected.