Trials of Amplification of the HEXA gene in human and turdus migratorius DNA determined by PCR and Gel Electrophoresis

By: Rachel Rick, Xavier Brandon and McKenzie Farthing

Abstract:

Tay Sachs disease is a hereditary neurodegenerative disorder caused by a mutation in the hexosaminidase A gene (HEXA) (Mahuran, 1999) and causes an excess of GM2 ganglioside in neurons resulting in cell damage (Myerowitz and Costigan,1988). Genetic testing is important for family planning, but enzyme deficiency tests cannot distinguish between mutant and heterozygous HEXA genes (Paw et al, 1990). The purpose of this study is to perform a more efficient way for genetic testing by locating and amplifying a gene in a sample of DNA through polymerase chain reactions (PCR) and analysis by gel electrophoresis. Furthermore, we attempted to determine the age of the HEXA gene by locating its homolog in an avian species. We hypothesized that using the designed primers and our controlled method, the amplification of the HEXA gene would produce a 481 bp length (Paw et al, 1990) and a 267 bp in its homolog turdus migratorius because of the specific attachments of the primers to the gene.
To establish a controlled method and ensure the reagents were functioning properly, PCR was used to amplify the 16s gene in E. coli and lambda virus Rz DNA. A semi-log plot was used to analyze the gel, and values of 449.88 bp and 445.44 bp were produced using two different forward primers on E. coli DNA. These values showed the amplification of E. coli was successful, as the expected is 530 bp. When analyzing the amplification of the Rz gene in lambda, the semi-log plot determined a base pair length of 513 bp. This is successful, as the base pair length for the Rz gene in lambda is 500 bp. When attempting to amplify the HEXA gene in humans, the semi-log plot determined a band length of 186.19 bp. With turdus migratorius, the semi-log plot determined a 152 bp band length. Both human and turdus migratorius had unsuccessful amplifications of the HEXA gene because the base pair lengths were significantly lower than our expected values. For future studies, we suggest a higher annealing temperature to help promote binding to the specific loci (Wu et at, 1990).

Discussion:

The HEXA gene is a vital component in the nervous systems of humans. It codes for the α-subunit of the enzyme 𝛽-hexosaminidase A. 𝛽-hexosaminidase manages GM2 ganglioside, a lipid that insulates the lysosomes inside of neurons (Myerowitz and Costigan, 1988). It digests excess GM2 ganglioside to prevent it from building up to toxic levels that could damage or destroy the cell. A mutation in both of a person’s HEXA genes renders them unable to produce 𝛽-hexosaminidase, resulting in an uncontrollable accumulation of GM2 ganglioside (Myerowitz and Costigan, 1988). This buildup of GM2 ganglioside and the detrimental effects it has on the cell cause Tay-Sachs disease (Mahuran, 1999).

There is a 𝛽-hexosaminidase enzyme deficiency test, but it cannot decipher between a homozygous recessive and heterozygous gene. For better genetic testing purposes, PCR was used to amplify the HEXA gene in humans and turdus migratorius and gel electrophoresis analyzed the amplification.  Our hypothesis was using a controlled method and designed primers, we can successfully amplify the HEXA gene in humans and turdus migratorius, which would result in a 481 bp (Paw et al, 1990) and 267 bp band lengths respectively. The human forward primer was designed to anneal to the 72,346,185 base pair to 72,346,200 base pair and the reverse to the 72,346,665 base pair to 72,346,639, which results in an amplified region of 481 bp. Furthermore, the forward primer will anneal to the first base pair to the 20th base pair and the reverse to the 251st base pair to the 267th base pair resulting in an amplified region of 267 bp in the turdus migratorius DNA.

In order to establish a successful polymerase chain reaction (PCR) method and ensure the reagents that will be used in the experiment are functioning properly, we amplified the 16s gene in E. coli DNA and analyzed each gel by a semi-log plot. Using the 8F forward primer and the 529R on E. coli DNA, the semi-log plot determined a band length of 445.45 bp. The expected was 530 bp, and thus it was in the accepted range.  We repeated the same methods using the 11F forward primer and the 529R on the E. coli DNA and the semi-log plot determined a band length of 449.88 bp. Again, this is in the accepted range, and amplification was deemed successful.

To reinforce the established controlled method, the Rz gene was amplified in lambda virus DNA. The Rz1F forward primer and Rz1R reverse primer were used to amplify the Rz gene, and the analysis of the semi-log plot determined the base pair length to be 513 bp. The expected base pair length was 500 bp, and the base pair length found was in an acceptable range for successful amplification.

The most prevalent form of Tay-Sachs disease is caused by the mutation 1278insTATC located on exon 11 of chromosome 15 and causes a four base pair frame shift mutation, resulting in a premature stop codon (Myerowitz and Costigan, 1988). Because of its frequent cause of Tay-Sachs disease, we focused on amplifying that specific exon in our experiment and used the PCR primers and temperatures used in Paw et al.  However, after using our edited controlled method and published primers and temperatures, we did not get any bands on the gel. We changed the cocktail by using the 10X thermopol buffer because it contained MgCl2, which is an important substrate for the Taq polymerase to add the DNTPs to the DNA strand to elongate the strand (Slack et al, 2011) and increased the additional MgCl2 concentration. After changing the protocol, we got bands on the gel, and the semi-log plot determined the band length was 186.19 bp, which rejects our hypothesis. This is incorrect, however, because when looking at the gel, the band length is smaller than the 100 bp of the Kb+ ladder. This difference in the actual band length and the calculated band length was because the calculated band length was determined by the line of best fit from the semi-log plot. The band length shown on the gel is an outlier, so the line of best fit would not accurately determine the base pair length. This error could have resulted from the primers annealing to each other rather than to the human DNA strand (Figure 8) or non-specific binding occurred. If this was the case,  the band would be smaller than the predicted band length, and this could be because of the high concentration of primers in our reaction cocktail (Brownie et al, 1997). Furthermore, Paw et al had a low annealing temperature of 45-48° C, whereas Wu et al suggests that an annealing temperature is optimized from the smallest primer and using the equation Tp= 22C + 1.46(Ln), where Ln is the smallest primer (Wu et al, 1991). Using the reverse primer, our optimal annealing temperature should be 51.2° C, and all of our trials had lower annealing temperatures.

In this experiment, we attempted to amplify the homolog of the human HEXA gene in the American Robin (turdus migratorius). We were interested in this species specifically because the American robin is the Michigan state bird and is a common forager around Michigan State University’s campus. Not only is this species relevant to the location of our research but locating the homolog in this avian species will give us clues as to how old the HEXA gene is. The widely used hypothesis proposes that the diversification of mammals and avians occurred rapidly after the Cretaceous/Tertiary extinction event 65 million years ago (Hedges et al, 1996).

We determined the 267 bp length by using the National Center for Biotechnology Information, which was predicted to be the HEXA gene in turdus migratorius. This was determined based off a study done by Zeng et al that discovered the HEXA gene in gallus gallus domesticus (chicken) and phoenicopterus ruber (American flamingo) (Zeng et al, 2008). Using the known HEXA sequence in these species, it was aligned with the turdus migratorius genome.  Furthermore, the protein sequence in the robin genome was aligned with the protein sequence of the human HEXA gene, and there was homology between the two. The primers were designed based off this genome sequence. Based off the smallest primer, the annealing temperature was calculated by the following equation: Tm= 4C x (#G+C in primer)+ 2C x (#A+T in primer) (Kampke et al, 2001) Problems associated with the HEXA sequence found in turdus migratorius is that it was classified by the National Center for Biotechnology (NCBI) as a class II antigen beta chain gene, but it did not list what chromosome this gene was on. Thus, with the limited information given, we were unsure if successful amplification would occur.

Using our edited control method that was also used in the human DNA cocktail and designed primers, a semi-log plot revealed a base pair length of 152 bp, which rejects our hypothesis. Though this was calculated by the line of best fit equation from the semi-log plot, the gel shows that the 100 bp of the ladder is larger than our amplified DNA. Similar to the human band length, the calculated band length is inaccurate because it is considered an outlier, and would not accurately be determined by the line of best fit from the semi-log plot. Figure 8 shows the unlikelihood of the two primers binding together, thus the smaller band size could have been from the primers annealing to non-specific areas. Using the Wu et al equation, the annealing temperature should be 45.36° C, however, the primers did not melt and were put in the thermocycler at a higher annealing temperature. Therefore, increasing the Kampke et al annealing temperature up to 2-5° C higher could promote more specific binding to the DNA strand (Roux, 1995).

Future Directions:

It is important to be able to amplify the HEXA gene in humans because it could potentially be used to diagnose people as heterozygous or homozygous for a mutant gene. For better successes with the amplification in human HEXA DNA, we would increase the annealing temperature to be in between 51.2-56.2° C. Paw et al had success with a lower annealing temperature, but when we used the published temperature, we did not have successful primer specific-binding. Using the Wu et al optimal temperature, it would be best to use 51.2° C for the primers to properly anneal to the DNA strand, and we could increase this temperature between 2-5° C.

For better successes with the amplification in turdus migratorius DNA, we would like to find more information about the turdus migratorius genome. There was limited information on the sequence, and the sequence found was for the class II antigen beta chain. We could try to increase the temperature to promote more specific binding, but if the sequence isn’t well known, then it may be better to find the HEXA homolog in a better-sequenced genome in a different avian species.

In the future, we would like to explore the homology of the HEXA gene in mice because mice contain the HEXA gene and can have mutations that affect exon 11 (Gravel, 1995).. Intriguingly, a previous study showed that when mice have the mutated HEXA gene, there is no difference in size, behavior, or reproductive activity to mice that had a functional HEXA gene (Phaneuf et al, 1995). It was suggested that there were no differences between mice with the disease and without because an enzyme called sialidase converts the GM2 ganglioside into GA2, which can undergo hydrolysis via the HEXB gene. This keeps toxic levels of GM2 low keeping more neurons alive. Humans also have this enzyme, but sialidase has a greater affinity in mice (Yamanaka et al, 1994). Studying the homology of the sialidase gene in mice and humans could lead us to a better understanding as to why sialidase has protective effects against Tay Sachs disease.

Figure:

Figure Six. Gel electrophoresis analysis of PCR amplification of Tay-Sachs causing HEXA gene in human DNA. A) The target HEXA gene located on exon 11 of chromosome 15 was amplified using the forward primer 5'GTGAACTATATGAAGGAGCTGGAACTG3' and the reverse primer 5'GGACAACTCCTGCTCTCAGG3’. The DNA target sequence between those two primers was 481 bp. The human DNA sample was obtained from wild type human cell suspensions provided by Lyman Briggs College at Michigan State University.  The PCR reaction cocktail contained 76 μL of distilled water, 22 μL of MgSO4, 8 μL 10 mM DNtp, 10 μL of the forward and reverse primer, 30 μL of 10X PCR buffer, 1 μL of Taq polymerase, and 3 μL of template DNA. The PCR cocktail was denatured for an initial 3 minutes at 95°C and ran for 34 cycles of denaturation for 45 s at 95°C, annealing for 45 s at 55°C, and extension for 60 s at 72°C. Gel electrophoresis was conducted in 0.8% agarose gel made using LB (lithium borate) buffer, agarose, and GloGreen. The gel was run at 125 V for 30 minutes and an additional 8 minutes at 135 V to analyze the PCR amplification of the human HEXA gene. M indicates the molecular weight marker 1-Kb Plus Ladder. 7 μL of 1-Kb Plus Ladder and 3 μL of loading dye (bromophenol blue) were loaded into this well. Lanes 1-4 were loaded with 7 μL of reaction cocktail and 3 μL of bromophenol blue loading dye. B) Migration distance vs. molecular size of 1-Kb Plus ladder was used to analyze the PCR products of the human HEXA gene. The semi-log plot above shows x-values that represent the distance in centimeters in which the bands of the ladder migrated down the gel and the y-values represent the actual size of the amplified region in base pairs. The equation y=136518x^-2.713 was obtained from a logarithmic trend line and was used to calculate the traveled distances of the DNA bands in lanes 1-4. The calculated band distance was 186.19 bp showing a much smaller size than expected. This could have occurred because the gel was run too long or because the primers annealed to each other. Further gel electrophoresis analysis is required to explore this problem.