Genotypic Identification of SCA Patients with the GLU6VAL Mutation
using Allele Specific PCR

By: Christopher Bejcek, Mitch Steur, Megan Dean, Lelia Boniadi

Abstract

The GLU6VAL mutation in the hemoglobin beta-globin (HbB) gene causes sickle cell anemia, which accounts for 60-70% of sickle cell diseases (Bender et al, 2012). The GLU6VAL mutation occurs in the sixth codon and is a single base pair substitution of a thymine for an adenine (Bender et al, 2012). It is hypothesized that an assay could be developed to differentiate between mutant and wild type individuals with sickle cell anemia by identifying the presence of the mutation on the HbB gene using allele specific primers under optimal conditions. DNA samples were tested for the presence of the sickle cell mutation using an allele-specific polymerase chain (AS-PCR) reaction. We predicted the PCR of the purified genomic DNA will amplify a region including codon six on the HBB gene at locus 11p15.4 where the Sickle Cell Anemia mutation occurs because of the primers designed to anneal to and amplify the mutation region (Alauddin et al, 2010). We amplified a 517 bp region using the believed wild-type DNA with (Waterfall and Cobb, 2001) control primers as well as Yaku-Bonczyk allele-specific design primers. We were unable to completely support our predictions due to non-specific annealing. In addition, we conducted research in a multi-aspect sociological experiment to explore SCA from an aspect of someone who suffers from the disease. The sociological experiment of SCA was explored in three parts: a survey of the student population on their knowledge of Sickle Cell Anemia, a walk-through emergency situation and mock simulation of SCA symptoms with a dog shock-collar, and experiencing how the public reacts to a social declaration of Sickle Cell Anemia through a t-shirt experiment. We predicted that individuals with Sickle Cell Anemia experience more negative sociological impacts because of symptoms and social awareness compared to someone without Sickle Cell Anemia (Morgan et al, 1986). Our research supported our predictions for our sociological experiment because we concluded that patients with SCA have different social experiences than non-SCA individuals. These experiments are beneficial because Sickle Cell Anemia may be detected more efficiently and the impacts of the disease will be better understood and managed.

Figure 5: Panel A: Electrophoresis of PCR reactions using the designed primers. Arrows in all panels indicate the expected fragment size of 453bp. W1 and M1 had a 46 ^oC annealing temperature, W2 and M2 had a 48 ^oC annealing temperature, and W3 and M3 had a 50 ^oC annealing temperature. Denaturation times were 95 ^oC for 30 seconds, annealing temperatures for 30 seconds and 72 ^oC for 35 seconds. The reactions were performed for 30 cycles. There is some non-specific binding, but it occurs least at 50 ^oC. Panel B: Results of PCR reactions performed at an annealing temperature of 50⁰C. W1 and M1, W2 and M2, and W3 and M3 were completed using a concentration of primers of 10 pm, 20 pm, 50 pm respectively. All reactions had a total volume of 50 μl. The number of cycles, times, denaturation and synthesis temperatures were the same as for panel A.

Discussion

Experiment Summary

Sickle Cell Anemia (SCA) is one of the most widely studied genetic mutations and is one of the most common sickle cell diseases. The frequency of the SCA allele is highest in sub-Saharan Africa, where in some communities, up to 40% of the tribal members may carry the allele because of its ability to help fight malaria (Allison, 1954). Although the SCA allele can have a positive impact on heterozygous (carrier) individuals that become infected with malaria, homozygous mutant (affected) individuals have a variety of adverse effects such as chronic and acute pain, damage to vital organs, and swelling of the hands and feet, all related to the lack of oxygen in the blood (Mayo, 2011). The SCA allele (HbS) has a single point mutation in the 6th codon of the beta hemoglobin (HbB) gene. The mutation is a transverse mutation of A to T, which results in a substitution of glutamic acid for valine acid (GLU6VAL) (Alauddin et al, 2010). PCR has been proven to diagnose genetic diseases such as SCA (Waterfall and Cobb, 2001), the question being answered is can we design a PCR based assay that can detect SCA. We hypothesized that if we develop allele specific primers to detect the single base pair mismatch and using calculated annealing temperatures, primer and salt concentrations we will be able to detect if patients have SCA. This study will not only determine how to diagnose an individual with SCA using PCR, but it will also give an overview on the daily impacts affected individuals face through a multitude of sociological experiments including a random sample survey that asked students about their knowledge of SCA, a public declaration of having SCA and the publics reaction to the declaration, a walkthrough at a hospital of what an individual with SCA goes through during a pain attack onset by SCA, and a simulation of a pain attack and fatigue.

Original Predictions

By purifying genomic DNA from IB3 human bronchial epithelial cells, C33-A, and HeLa cells, PCR was used to detect SCA with the control primers WT-AS (5′-ATGGTGCACCTG ACTCCTGA-3′), WT-CP517 (5′-CCCCTTCCTATGACATGAACT-3′) and amplify a region of DNA that was 517bp long. The Mutant control primers MUT-AS (5′-CAGTAA CGGCAGACTTCTCCA-3′), and MUT-CP267 (5′-GGGTTTGAAGTCCAACTCCTA-3′)(Waterfall and Cobb, 2001), were also used and amplified a region of DNA 267bp long though it was not expected due to the DNA most likely being homozygous wild type. A possible reason for both of the primer sets working on wild-type is with a single base pair mismatch a pseudo positive result may occur (Yaku et al, 2008). Our experimental design also used a total of three different design primers: Fprimer1 (5'- GGCAGTAACGGCAGACTTCTACT -3'), Fprimer2 (5'-GGCAGTAACGGCAGAC TTCTACA -3') and the reverse primer Rprimer1 (5'- CTTCCACTTTTAGTGCATCAATTT- 3'). The difference between the forward primers is a single base pair at the 3' end, which differentiates between the mutant and the wild type hemoglobin alleles. Our primers are slightly longer to enhance annealing during the PCR reaction (Waterfall and Cobb, 2001). Although both forward primers will result in the same sized fragment being produced, only the F1primer should be able to amplify a product from the HbS allele. In contrast, the Fprimer2 should only produce a product from the HbB allele. If the individual’s genotype was homozygous HbB, it was hypothesized that there will be a band of 453 bases when the Fprimer2 is utilized, but no band will appear when Fprimer1 is used. If a heterozygous genotype is present, faint bands are expected to be present in both the Fprimer1 and Fprimer2 reactions due to the fact that both the mutated allele and wild type allele are present (Waterfall and Cobb, 2001). Finally, in an individual who was HbS homozygous a PCR product should only be obtained when the Fprimer1 is used.

Results and Ultimate Findings

Conditions and parameters for the control primers matched (Waterfall and Cobb, 2001) as closely as possible. To determine the conditions that are optimal for PCR, a variety of trials were performed to determine the optimal concentrations of primers and DNA as well as the optimal annealing temperatures and MgCl₂ concentration. The annealing temperature was calculated to be 50^o C based the calculated primer melting temperatures (see Methods section) and which annealing temperature resulted in the clearest bands. Due to the purity of the DNA isolated from the HeLa and C33-A cells a lower concentration of primers were used to decrease the chance for non-specific binding. As you can see in Figure 4 and Figure 5 non-specific binding did still occur but when the annealing temperatures were raised to 50^o C it was significantly decreased. The bands were found to be the expected length to support our hypothesis of using PCR as a method of diagnosing the Glu6Val mutation. Furthermore, our hypothesis was contradicted due to the presence nonspecific annealing. The non-specific annealing can be explained by the single base pair mismatch at the 3' end allowing for elongation (Yaku et al, 2008).

With the data collected from our sociological experiments it was determined that people with SCA experience different social experiences than people without SCA. The first test was a survey given to people on MSU's campus. The majority of people Strongly Agreed (5) that SCD does impact a child’s school performance although they had never head of Sickle Cell Disease. This implies that there are sociological aspects, other than knowledge about the disease, that indicate the severity of not being able to perform in school (Figure 6). For the second test each group member went to public places such as the mall, gym, and dorm halls and passed out an informational pamphlet while wearing a shirt that declared they have SCA and another shirt declaring that that they went to summer camp (Table 1). The third part of our sociological experiment was a walk through of what a SCA patient goes through when they are admitted to a hospital during a pain epidemic. The last part of our experiment a shock collar was used to experience how symptoms of SCA affected a persons everyday life. The data collected shows that the pain episodes from SCA effect a persons everyday life (Figure 7)

Future Directions

To improve our experiment new primers could be designed so that we would not have a single base pair mismatch on the 3' end of our primers, which would help to alleviate the probability of non-specific binding (Yaku et al, 2008). Also the primer concentrations could have been lowered even more to help with the non-specific binding due to the purity of our DNA. To help get more pure DNA it would also help if we had let the IB3 cells soak into the matrix more in the capture column of the Qiagen DNA purification kit. To get more pure DNA from the IB3 cells we should not discard the supernatant level of waste as the Qiagen kit calls for because it is possible that it contains the DNA needed.

To improve the sociological experiments more trials could have been run to increase accuracy although the data collect did still support the hypothesis. We also could have went to more diverse places such as the Mall, the Library, the Capitol, and the Gym to make sure we got more of an array of responses from people who are young and old and of different levels of education.

Sociological Experiment video: https://www.youtube.com/watch?v=dE0LYh57OlM