Identification
of Hemophiliac R2116X Genotype and Healthy
Genotype in Human S9 Cells using PCR
Breanna Borg, Jessica Goldsworthy, Melanie Jamel, Jacob Ward
Abstract
The R2116X mutation of the coagulation factor VIII (F8) gene
is one of the many point mutations that results in
severe Hemophilia A. This mutation is the result of a substitution from
cytosine to thymine at the 131,621st base pair, resulting in a codon change
from CGA to TGA for the 2,116th amino acid (Levinson, et al, 1987). We designed
primers that will amplify purified wild-type DNA using PCR amplification
methods. The purpose of this is to correctly analyze a genotype, which is very
useful in medical diagnosis. We hypothesized that the wild-type
primers will amplify wild-type DNA, using PCR methods to denature the DNA,
allowing our primers to anneal at 58¡C. Where Taq
polymerase will add nucleotides to the 3Õ end at 72¡C to complete amplification
(Wittwer, et al, 2012). It was determined that
unsuccessful amplification was distinguished by a 460 b.p. band not appearing in
the gel electrophoresis when using the wild-type primer. Using published
primers 9F and 9R by Shin-Yu Lin et al. as a control, unsuccessful
amplification of exon 9 occurred. Using PCR as a diagnostic assay is
advantageous for early detection of disease. To understand the symptoms and
difficulties encountered by a hemophiliac, each researcher emulated the
symptoms as part of a 30 days experiment. The
experiment was designed to record the psychosocial and sociological effects and
analyzing them using a Modified Global Assessment of Functioning (mGAF) scale. The results were significant between every
week except for control vs. Part I and Part III vs. Part IV. In part II, the
pseudo-bruising caught the attention of a significant amount of people, the
mean percentage being 5.75% with a p value of <0.05. After living with
hemophilia symptoms for 30 days, the researchers gained an overall awareness of
the disease, inferred from a decrease in bruising instances by 58.3%. The implication
of the psychosocial and sociological experiment allowed researchers to
appreciate the challenges faced from the disease by resembling the lifestyle of
a hemophiliac.
Figure
2: Agarose Gel electrophoresis results from the
analysis of Lambda virus Rz Gene primers and
wild-type DNA. Columns 1 and
7 display the 1000 base pair DNA ladders. Columns 4, 5, and 6 are the amplified
regions of the Rz gene at 456 base pairs. The Rz1F
primer is 5Õ – GATGTATGAGCAGAGTCACCGCGAT -3Õ and the Rz1R primer is 5Õ
– GAGGGTGAAATAATCCCGTTCAG – 3Õ. The 1% gel was made my mixing .4 g agarose with 40 ml 1x TBE buffer and 2.5 μl sybersafe. PCR was
conducted using the thermo cycler, with an initial denaturation temperature of
95 ¡C for 2 minutes, followed by 30 seconds for 30 cycles. The annealing
temperature of 55 ¡C ran for 40 seconds and the extension at 72 ¡C cycled for 1
minute. To run the gel electrophoresis analysis, 5 μl
of the Rz PCR cocktails were loaded into the agarose gel with 3 μl of
loading dye. The gel was exposed to 100 volts of electrical current for 45
minutes to run the analysis. The gel was then taken out and photographed under
the Kodak Gel Logic 200 for UV transillumination. The
bands in the electrophoresis appear to be ~ 500 b.p. which is the
hypothesized amplified result.
Discussion
Hemophilia A is an X-linked
recessive blood disorder in humans (Aubin et al,
2004). A deficiency in coagulation factor VIII is responsible for 85% of
Hemophilia A diagnosis (Kleigman et al., 2011).
Because Hemophilia A is an X-linked recessive disorder, it is much more common
in the male population, affecting approximately one in every 5,000 males born
in the United States (Scott and Montgomery, 2010). In order for a female to
have hemophilia, both of her X-chromosomes must have a mutation for the
disease, a much less likely scenario. The female is a carrier more often,
requiring only one mutated X-chromosome (Rosslter et
al, 1994). R2116X, one of the hundreds of mutations that lead to a deficiency
in coagulation factor VIII and ultimately hemophilia, was the mutation examined
in this experiment. This acronym describes that a nonsense mutation occurred at
2,116th amino acid of the FVIII gene. The substituted base pair was cytosine to
thymine at the 131,621st bp of the FVIII gene (Kniffin et al, 2011). The resulting premature stop codon
truncated the 216 remaining codons, greatly affecting the synthesis of the
coagulation factor (Kniffin et al, 2011) (Levinson et
al, 1987). Due to this, individuals with hemophilia experience symptoms such as
easy bruising, consecutive nosebleeds, and in more severe circumstances,
massive internal hemorrhage and loss of functionality at the joints.
To
determine if the R2116X mutation was present, we constructed primers that would
only anneal to specific regions of the DNA sequence (See Methods: Primers). We
designed our primers to contain at least 40% guanine and cytosine content, due
to the 3 hydrogen bonds between the two bases (Hyndman and Mitsuhashi,
2000). The concept determined that the WT-R and WT-F primers would bind to the
wild-type DNA and result in successful PCR amplification, yielding a band in
the gel electrophoresis at 460 bp, the distance
between the forward and the reverse primers. DNA amplification size was
contained to a segment between 100 and 1000 base pairs in length. This
technique was employed to have the amplification large enough for visualization
on the gel, but small enough to avoid difficulties in the extension phase
(Hyndman and Mitsuhashi, 2000). Successful PCR and
amplification should only occur at the desired site because each primer would
complement the 26 base pairs of the template DNA (Saiki et al, 1988). If the
primer does not complement the DNA strand, annealing and extension would not
occur, resulting in a negative test and no band in the gel electrophoresis (Dieffenbach et al, 1993). If a band was evident in the gel
but appeared at a different height, the primers created did not anneal to the
target region on the FVIII gene (Ganguly et al,
1993). A lack of a band appearing could be explained by a variety of factors.
Some of these factors could be errors during the designing of primers (such as
primer dimer and nonspecific binding), miscalculations in annealing
temperatures, or a DNA sequence that does not match the one supplied on GenBank Database for where the primers would anneal.
Experimental difficulties
included determining a successful cocktail mixture to amplify the targeted DNA
using the published primers as seen in the Lin et al. experiment. The project
was used to determine locations of missense and nonsense mutations on the FVIII
gene and was successful in mapping out the 26 exons of the respective gene
using designed oligonucleotide primers. The experiment used two primers for
each of the exons, exclusively a forward and reverse couple. As a control for
our experiment on the FVIII gene and particularly the R2116X mutation, we used
the 9th exon pair of oligonucleotides, 9F and 9R. Over 10 separate
trials and 2 different genome purification sequences were conducted to perfect
the procedure so the primers would anneal and Taq
polymerase would extend. In the first session of testing the control primers
with our template DNA, we conducted three separate trials. Each reaction
cocktail was separately made, ensuring all of the necessary components were
present, and finally run in the thermocycler using
our standard PCR durations for denaturation, annealing, and elongation. A
gradient was placed to ensure that the annealing temperature was reached and
with lower temperature, would make for a more successful site to primer
attachment. One reaction cocktail was at each of the following: 51.2¡, 48.9¡,
and 46.9¡ C. When tested the following lab period, no amplification was present
in the gel electrophoresis analysis. Both of the samples from the two genome purification trials were used for
troubleshooting. No visible bands were ever shown for either of the samples.
Analysis with the Epoch UV spectrophotometer gave results for a 260/280 ratio
of 1.07. Proteins absorb at 280 nm whereas nucleic acids absorb at 260 nm. A
1.07 value signified a large amount of protein contamination in the DNA sample,
meaning DNA in both samples was not adequate for use, which could have been a
huge factor in why amplification wasnÕt occurring.
The
second session in testing our control primers, was done through master mix
technique in which all component volumes needed originally were multiplied by a
factor of 10. The volumes of each component then would be large enough to be
visible to the naked eye, and would ensure that they were entering the mix
before proceeding. For these trial runs, 5 reaction cocktails employed our
purified DNA and the remaining 5 reaction cocktails employed DNA acquired from another
group, whom was successful in getting bands for their own genome prep analysis.
Again, the gradient was utilized in the thermocycler.
As an additional way to experiment on the cocktail components, we reduced the
amount of DNA template in a few mixtures, making more space for amplified
product. Primer volume, Taq volume, and even
concentrations of magnesium and chloride ions in the buffer were changed. No
bands resulted from any of the 10 cocktails.
As
a way to test and confront issues that we were experiencing with the gel,
cocktail mixture volumes, and the ladder, the
lambda virus control experiment was conducted using Rz1-F and Rz1-R primers
(See Methods: Primers) (Figure 3). When the experiment determined that there
was no issue with the gel or the cocktail volumes, it was determined that the
problem was either with the DNA sample or the control primers. Ultimately,
since successful DNA was also used in testing the primers to no avail, the
final issue rested with the primers. Four more trials were run on the control
primers using the same cocktail mix as that of the lambda experiment, with
decreased Taq and DNA template. No bands resulted
from any of those either.
As a control for
pipetting, 10 trials of pipetting varying volumes of water were done at 50 µl,
100 µl, 150 µl, and 200 µl. After before and after weights were compared to
amount pipetted, a t-test analysis was conducted (see Results: Control
Primers). The p values were all above 0.05, meaning there was above 5% chance
that the results were random, showing no significant difference in density of
the samples.
Along with experimentally locating a
severe form of the FVIII mutation, we created an intellective psychosocial
experiment conducted over 30 day duration to gain a better understanding of the
sociological and psychological experiences of patients living with Hemophilia
A. Four different parts were executed during the 30 days (explained in Results:
The 30 Day Experiment above). In Part I of the experiment, significant
difference can be seen in how overall awareness for potential bruising/bleeding
increased over the four week period symbolized by the decrease in instances
(Figure 4). For Part II, we concluded with a mean percentage of people with
response at 5.75% and a p-value of < 0.0001 when comparing control and experimental trials (Figure 5). Essentially, having the
bruise present increased public response, as we predicted;
and because the p-value was below 0.05, meaning there was less than a 5% chance
for randomness in results, we can conclude that there was significance between
responses in the control and experimental trials. For additional purity of the
data, the same locations were visited and the same clothing items were worn in
both cases. In Part IV, individual budgets were planned based off preliminary
data of average spending. Allowed spending was derived by
dividing average spent in half (Figure 6). Because hemophiliacs often
require continuous doctors and dentists visits, physical and psychological
therapy, and often even nasal spray drugs for coagulation factors and blood
transfusions, being on a budget is extremely vital. The limit placed on money
used for recreational activities, together with physical restrictions caused by
prolonged nosebleeds in Part III, had significant influence on psychological
scaling as determined by the Modified Global Assessment of Functionality Scale
(DSM-IV-TR, 34). As a control, the mGAF scale was
taken a week prior to Part I, and weekly from then on, providing continuous
data in which to compare changes in functioning. An ANOVA test showed
significance between results as p <0.05 (Figure 7). The only exceptions to
this was results found between control and Part I and Part
III to Part IV. No real change occurred within these time frames,
justifying lack of significance. The average of our combined mGAF results throughout the 30 Days decreased from 82.75 to
61.75, showing decrease in functionality, mainly due to anxiety and depression,
but nothing that would daunt living a relatively normal life (Health, 2010).
30 Days YouTube Video Link: