Detecting Point
Mutation on COL5A1 Gene in Human IB3-1 Epithelial Cells by PCR and Gel
Electrophoresis for EDS
Goodall Girls
Kasey Mackley,
Bevneet Grewal, Amy Savoie, and Carmen Metzger
Abstract
One third of all patients diagnosed with classic type Ehlers-Danlos
syndrome (EDS) are born with a mutation on the COL5A1 gene, leading to an
insufficient amount of type V collagen in the body (Malfait et al, 2005). A
cytosine to thymine point mutation on base pair number 155202 in the COL5A1
gene is one of the many mutations known to cause the classic type of the
disease. This mutation substitutes a glycine (CAA) with a stop codon (TAA) in
position 3184 of the proα1(V) collagen chain, which ultimately results in
an inadequate production of type V collagen (Malfait et al, 2005). DNA from
human IB3-1 epithelial cells was extracted using genome purification (Qiagen,
2010). We hypothesized that by using the correct primers, annealing
temperatures, and cocktail solutions, polymerase chain reaction (PCR) can be
used to accurately detect the presence or absence of the C3184T mutation
through the annealing of designed primers to the mutation site (Borck et al,
2010). The amplified DNA was used in gel electrophoresis to identify the
presence or absence of a 703 base pair long band, indicating the genotype of
the DNA (Borck et al, 2010). Based on which forward primer was used, we were
able to determine whether the DNA was homozygous wild-type, heterozygous, or
homozygous for the mutation. To personally familiarize group members with EDS,
members displayed physical symptoms commonly present in EDS patients.
Quantitative results were obtained based on societyÕs positive or negative
responses as well as group memberÕs anxiety levels as the progressive
sociological experiment continued. We hypothesized that the progressive nature
of the sociological experiment, which gradually added symptoms over a set
period of time, would cause increasing levels of anxiety in group members due
to an increasing amount of attention and negative responses from society
(Castori et al, 2011). T-test results showed a significant difference (p<.0001)
between the negative reactions in the control trial and the negative reactions
in the progressive trials after that, and these results ultimately caused
anxiety levels to increase in group members. This study is significant in
helping doctors to accurately diagnose EDS patients with this point mutation,
as well as giving group members a chance to experience life with EDS.
Figure
Successful PCR and gel electrophoresis of a fragment
of the COL5A1 gene. PCR was performed using a forward primer (5ÕAAGCCCAATCCAACCCAAGTC
-3Õ) and a reverse primer (5ÕGCCCTTCATTGCCTTTCAGTC -3Õ). Both of these primers
were used as controls in the experiment. PCR was ran for 30 cycles with an
annealing temperature of 51⁰C. Gel electrophoresis was performed in a 1% agarose
gel with TBE buffer. 9µl of PCR product was inserted into the first well using
a pipette. 9 µl of the Fermentas 1KB+ DNA ladder was inserted in the second well
to assist in analyze band length of the amplified PCR product. The gel was ran
at 95 volts for 35 minutes. The gel was then examined under UV light for band
length analysis. The band was determined to be about 400 base pairs long in
comparison with the DNA ladder. A
semi- log plot was created for the result obtained from gel electrophoresis of
the amplification of a fragment of the COL5A1 gene. The plot was used to
predict the base pair length of the fragment of the COL5A1 gene. The migration
distance represents the distance traveled by the fragments in the ladder. The
molecular size represents the corresponding band length of each of the bands in
the ladder. The line has an equation of y=1561x-2.88 and an R2 value of .99. The equation was found using the best fit line
and was used to find a more exact base pair length of the amplified band. By using the equation of the line, the
value of the amplified band was found to be 425 base pairs long, extremely
close to the band length originally predicted, which was 473 base pairs long.
Discussion
Experiment Summary
Ehlers-Danlos syndrome (EDS) is an autosomal dominant connective tissue
disorder that is characterized by hyper elasticity of the skin, delayed wound
healing, hyper mobility of joints, and easy scarring and bruising (Malfait et
al, 2010). A form of classic EDS is caused by a mutation, C3184T, on the proα1
(V) collagen chain of the COL5A1 gene, located on chromosome nine between
positions 34.2 and 34.3 (Malfait et al, 2010). This point mutation, at base
pair 155202, changes the base pair sequence from cytosine to thymine. (Borck
et al, 2010). The substitution causes a glycine to become a stop codon at
position 3184 of the proα1(V) collagen chain. The early stop codon
negatively affects type V collagen, a protein necessary for rigidity in
connective tissues (Symoens et al, 2008). We hypothesized that PCR can be
used to accurately test for the presence or absence of the single base pair
mutation C3184T in the COL5A1 gene
using the correct amount of primers, annealing temperatures, and cocktail
solutions to indicate the existence of the EDS genotype in an individual. PCR
testing has been extremely effective in gene mutation analysis (Elnifro et al,
2000).
EDS may cause patients to live in trepidation of being judged and
furthermore give patients great anxiety when trying to do daily tasks that are
altered, or inhibited by having EDS (Berglund et al, 2000). In order to further
develop our understanding of EDS, we examined the sociological responses of a
person with EDS as well as the personal anxiety of a person with EDS based upon
those responses. We hypothesized that through experiencing the symptoms of EDS
we will better understand how a mutation in the COL5A1 gene can cause society
to have more negative reactions to us, thus increasing our individual anxiety
levels. After taking one control and living with symptoms of EDS for six
progressive trials in three weeks, group members became irritated and
frustrated with the interactions of those around them, which ultimately gave
each individual more understanding of the anxiety caused by EDS (Castori et al,
2011).
Original Predictions
The DNA from the human IB3-1epithelial cells was run with five primers:
the forward control, reverse control, designed wild-type forward, designed
mutant forward, and designed reverse primers. It was predicted that the forward
control primer and the reverse control primers would anneal to the DNA in the
IB3-1 cells and create a 473 base pair band because the primers are meant to
anneal to wild-type DNA (Borck et al, 2010). It was also predicted that the
wild-type forward designed primer and the reverse designed primer would anneal
to the wild-type DNA and create a 703 base pair band because the primers are
also meant to anneal to DNA that does not have the mutation (Borck et al,
2010). Lastly, it was predicted
that the mutant forward and the reverse designed primers would not amplify a
segment of the wild-type DNA because the mutant forward primer is meant to bind
to the C3184T mutation, which the wild-type DNA was predicted not to contain (Borck
et al, 2010).
Results and Ultimate Findings
Two
experiments were used as controls for the experiment. One of the experiments
amplified a portion of the RZ gene of the Lambda Virus using two previously
determined forward and reverse primers run at an annealing temperature of 51⁰C. This amplified a band
approximately 370 base pairs long, extremely close to the predicted value of
395 base pairs long. The second experiment consisted of a control forward
wild-type primer and a control reverse primer, obtained from a previous PCR
assay, that bound to DNA from human IB3-1 cells to amplify a 425 base pair
band. This value, found by an equation obtained using the line of best fit, was
fairly close to the 473 base pair long band that was amplified in the previous
PCR assay (Borck et al, 2010) The band was found using PCR and gel
electrophoresis with an annealing temperature of 51⁰C.
Another experiment using the wild-type forward and reverse designed
primers amplified a band at about 686 base pairs using an annealing temperature
of 47⁰C. This was
extremely close to the predicted value of a 703 base pair long band. There was
also an unexpected band at approximately 2,847 base pairs, which was thought to
be a result of non-specific binding. Many other trials were done using the
wild-type forward primer and reverse designed primer to obtain clearer bands.
Salt concentrations were adjusted as well as annealing temperatures and the
amount of DNA in the cocktail; however, these trials and adjustments were
unsuccessful. The last trial done was with the designed mutant forward primer
and the designed reverse primer. PCR was run using four different annealing
temperatures: 52.9⁰C, 51.2⁰C, 48.9⁰C, and 46.9⁰C. Gel electrophoresis was run
showing that the designed mutant and reverse primers did not anneal to the
mutation site at any of the annealing temperatures. This was expected because
the DNA of the human IB3-1 cells was not expected to contain the mutation that
the primer was designed to anneal to. The results from the PCR experiments that
were conducted confirmed the hypothesis that PCR can be used to accurately test
for the absence of the single base pair mutation C3184T in the COL5A1 gene, but it did not
confirm nor refute the hypothesis that PCR can be used to accurately test for
the presence of the C3184T mutation in the COL5A1 gene.
A sociological experiment was conducted to increase group memberÕs
understanding of what it is like to live with EDS. Positive and negative
responses of society were recorded through a series of progressive trials
simulating the many physical symptoms of EDS. As the weeks progressed, the
number of EDS symptoms simulated by group memberÕs increased. We hypothesized
that the negative responses would increase and the positive responses would
decrease as the symptoms of EDS were progressively added on. There was a
significant increase in negative responses between week 1 (control) and the
subsequent weeks (p<.0001), which confirmed our original hypothesis. The
psychological portion of our sociological experiment focused on levels of
anxiety caused by EDS. Anxiety scores were recorded after each trial using the Zung
Self-rating Anxiety Scale. We hypothesized that the progressive nature of the
sociological experiment would cause increasing levels of anxiety in group
members due to an increasing amount of negative responses from society. There
was an overall increase in anxiety levels from the control trial to the final
trials of the experiment, which supported our hypothesis.
Errors
Many trials of PCR were run, while many were also unsuccessful. The failure of
amplification may have been due to: incorrect annealing temperatures, incorrect
salt concentrations, or improper annealing of primer sequences. Incorrect
annealing temperatures may have been due to improper or varying calculations of
melting points. The non-specific binding of the wild-type and reverse designed
primers may have occurred due to improper annealing of the primer sequences.
Multiple trials of each PCR assay were completed to rule out the possibility of
human error.
The sociological experiment data may have been skewed due to bias. The
expectation was that societyÕs negative interactions would increase as the
symptoms of EDS increased. The observations of interactions may have been less
biased if an outside viewer had watched and recorded the interactions between
the group member and society. Anxiety scores obtained using the Zung
Self-rating Anxiety Scale could have been taken prior to each trial in addition
to after each trial to remove personal bias and increase accuracy.
To continue our research, human blood cells containing the
C3184T point mutation for classic EDS will be obtained. The control
primers as well as the designed mutant forward primer, wild-type forward
primer, and reverse primer will be run on the DNA from the cells containing the
mutation for classic EDS. PCR amplification is expected to form a 703
base pair band when the designed mutant forward primer and the reverse designed
primer are ran through PCR with a temperature gradient of 46-48. The PCR
products will then be ran in an agarose gel and analyzed using gel
electrophoresis along with a graph of base pair length verses migration
distance to determine if the correct band length was amplified during PCR.
We will also design a new reverse primer with a closer
melting temperature to the designed mutant and wild-type primers in order to
get a closer temperature range as well as a higher annealing temperature. The
primers will be re-analyzed during this process to assure that there will be no
more non-specific binding due to improper annealing of primer sequences.
There are many other mutations that cause
classic EDS including: nonsense mutations, frame-shift mutations and
splice-site mutations (Mitchell et al, 2009). Some of these other mutations
will be tested and analyzed using PCR and gel electrophoresis in order to
better understand the disease. Specifically testing the other premature
stop codons for EDS will be the primary focus in these experiments. In doing
this, we may be able to learn more about how stop codons have an effect on the
proα1 (V) chain and learn how to treat them in people with EDS.
View our sociological experiment on
living life with EDS: