Detection of the A467T Mutation on the POLG Gene in IB3 Epithelial Cells by

Allele Specific PCR and Gel Electrophoresis 

 

 

 

 

 

 

 

 

 

 

 

By: Ashwin Easow, Brooke Hagen, Alyssa Kirsch, and Alexander Lyons

 

 

 

 

 

 

 

 

 

 

 

 

 

LB 145 Cell and Molecular Biology

Tuesday and Thursday 7PM

Eric Gurzell, Tim Oja, Rachel Rinaldi

4/23/2013

 

 

 

 

 

 

 

Abstract

 

       The purpose of the research was to test published and customized primers with genomic DNA of wild-type and mutant patients through PCR amplification and gel electrophoresis to ultimately diagnose AlpersÕ disease. Published primers were provided by Dr. Naviaux to test if we could replicate his results in identifying the point mutation. Bands did appear in the replication study, but failed to be identified in the correct base pair region. We designed our own forward and reverse primers: wild type Fprimer 1, mutant type Fprimer 2, and Rprimer. They were created by complementary base pairing to template DNA. The A467T mutation would be detected if a band appeared at 518bp when Fprimer 2 was run with mutant type DNA, while the normal DNA sequence would be detected if a band appeared at 518bp when Fprimer 1 was run with wild type DNA. Both forward primers were run with the reverse primer, and wild type DNA template at an annealing temperature of 59¡C. A base pair length of 518bp was expected for Fprimer 1, but appeared at 125bp. In the AlpersÕ Disease Symptom Project (ADSP), all members were required to live with replicated symptoms of AlpersÕ disease to understand the physical, sociological, and mental aspects of the disease. Symptoms included blindness, stiff joints, and inability to walk for a total of a month. Fitness was tested by taking a presidential fitness test every week. Since movement and vision were both lost, adjusting to the symptoms would be difficult and require assistance to function. The psychological effects of the challenge were evident after taking the Hamilton Depression Scale, where the rate of depression increased between pre and post experiments due to the hardships. The sociological aspect was conducted by recording the number of adverse reactions that bystanders expressed at the locations of Holmes, Hubbard, Brody, and Grand River. A Chi Squared Test was conducted and showed that there was a significant difference in Brody and Grand River. Significance of this research will allow further research on developing efficient primers and show that more sentimental care is needed by the public to reduce stress that the symptoms provide.

Discussion

            Before working with IB3 epithelial cells, Lambda DNA was used as a control. We amplified the Lambda virus Rz gene using 1% agarose gel electrophoresis. With this control, we predicted the wild type primers to bind the wild type DNA. Our forward primer 5Õ GATGTATGAGCAGAGTCACCGCGAT 3Õ and reverse primer 5Õ GAGGGTGAAATAATCCCGTTCAG 3Õ were used to bind to the wild type Rz gene. A DNA cocktail was put together and ran for 30 cycles, annealing at 65¡C for 46 seconds. The gel was run for 30 minutes at 103 volts. At these conditions, the PCR was successful showing one band which infers the primers bound successfully. The Lambda virus Rz gene was successfully amplified around 500 base pairs.

            With our A467T mutation, we found Dr. Naviaux, who conducted similar research to the A467T mutation we were trying to amplify. Using his published primers we ran PCR and gel electrophoresis. The primers we used included: the forward primer  5Õ- GTC TTG CCT CCT GTG GTC ATT TAT 3Õ and the reverse primer 5Õ- CAC CCA TGC TCC CCA CCT TTC CT 3Õ. For PCR, we ran 10 tubes containing a different cocktail in order to see if adjusting the amount of buffer, taq or DNA would lead to success in amplifying the A467T mutation. In the first and second tube, we put 3uL of DNA and doubled the PCR to 10uL. The tubes were run using PCR for 35 cycles with Tube 1 annealing at 50¡C and Tube 2 at 53.8¡C each for 40 seconds. Tubes 5 and 6 were run in PCR for 35 cycles with Tube 5 annealing at 50¡C for 40 seconds and Tube 6 annealing at 53.8¡C for 40 seconds. As shown in Figure 2, bands were apparent at 503 bp (as suggested in Dr. NaviauxÕs publication); however, non-specific binding was present. With detectable bands, this meant that doubling the amount of PCR buffer was effective. Having more buffer may have been beneficial to the cocktail by keeping the pH more stable during PCR and allowing the primers to anneal better. This may be because of ÒThe basic underlying observation that standard PCR buffers prevent chromatin solubilization during thermal cycling while more loosely organized chromatin can be amplifiedÓ (Vatolin). As for the other wells, we varied the amount of taq and DNA included in each cocktail. With an increase of taq, that seemed to not help with binding since no bands were present in the wells where the taq was increased. The concentration of agarose may have been higher in that area making it harder for the DNA to run. The amount of DNA did not seem to matter since bands were evident when using both 1uL and 3uL. As for the non-specific binding, this could have been due to running it at a lower temperature and shorter times. Since we had to share the thermocycler, it did not allow everyone to run their PCR independently of one another, and we were unable to run it for the full time suggested in his publication. 

            For our customized primers, we used complementary base pairing to amplify the A467T mutation. This differs from the standard method that we used due to not specifically analyzing a place for the mutation to be. The primers used to amplify the mutation were 5ÕAGAAGTCGTTGATGGATCTGGCC 3Õ for the forward and  5Õ TTGAAACTCCTCCTCCTCACTGC 3Õ for the reverse. Similar to running our published primers, we had 9 tubes with different cocktails to increase the chances of getting bands. In the 3rd and 4th tube, we changed the annealing temperatures for the tubes as well. Tube 3 had its annealing period for 40 seconds at 50¡C whereas tube 4 was at 53.8¡C for the same amount of time. In addition, tubes 7 and 8 contained 1uL of DNA, 10 uL of PCR buffer. Tube 7 had its annealing temperature at 50¡C and tube 8 had an annealing temperature of 53.8¡C for 40 seconds. With these lowered temperatures, we increased the chances of binding to occur. If the temperature was too high then bands would not be visible. The 1% agarose gel was run at 108 volts for 30 minutes. Bands were expected to show up at 518 base pairs however this ended up not being the case. Some bands were visible however the bands showed up around 120 base pairs. This was determined due to conducting a semi log plot. The most vibrant bands were in well 3, 5, and 6 which contained Tubes 4, 7 and 8. However, non-specific binding was present. In these wells the PCR buffer was doubled. The buffer could have stabilized the pH during denature and annealing which may have contributed to binding. In addition, the PCR buffer provides chromatin solubiliztion during PCR so that more loosely chromatin can be amplifiedÓ (Vatolin). In addition bands showed up in wells 8,9,10 and 12. In these wells, the cocktail contained doubled taq. However, more taq seemed to not have the same results as the buffer. Yet, with increased taq, bands were semi-visible due to it enabling the amplification reaction to be performed at higher temperatures which significantly improves the specificity, yield, sensitivity, and length of products that can be amplified (Saiki et al, 1988). As for mutant primers binding with wild-type DNA, the forward sequence was 5ÕAGAAGTCGTTGATGGATCTGACC 3Õ along with the reverse which is 5Õ TTGAAACTCCTCCTCCTCACTGC 3Õ. The only difference is the intentional base-pair change to ACC at the 3Õ end. With these primers used together, no bands were present. This is due to the base-pair mismatch.

            For genomic purification we were giving 1,000,000 IB3 epithelial cells to purify. This is to remove the proteins and such to leave just nucleic acids. We were given 3 tubes of DNA due to the cells being liced or not preserving the cells the proper way. DNA broke out of cell, which is why when following the procedure, and running genomic purification there was no DNA in the tube. However, for the third tube of DNA we spun the cells down, yet there was a white, sticky substance on the side that we were not sure of. We took the substance and ran genomic purification on it using the Epoch and found it was DNA. For this DNA, our 280 value was .004 and .005. The 280 value is the concentration of the protein in milligrams per milliliter. The aromatic amino acids in proteins absorb strongly at 280 mg/mL. As for the 260/280 values, we got 1.789 and 1.537. The values should be around 1.8. With numbers higher than this value suggests that it is ready for analysis. However a lower number may mean that there is protein contamination (Oxford Gene Technology, 2013).

            In our first week of the AlpersÕ Disease Symptom Project, we first took a HamiltonÕs depression test to see where we stood before experiencing this disease. With this test, we wanted to see if having these symptoms would create a drastic increase of depression. We predicted each week our scores to increase, and by the end, have severe depression. For the first week, our average of 9.2 revealed little depression, which may be due to college stress and other circumstances. In addition to this depression test, we took an adult presidential fitness test. The test was taken the first week as a control to compare to the following weeks and monitor the affect the symptoms have our physical activity. Our average for the first week was in the 45 percentile. Moreover, we went to Holmes, Hubbard, Brody and Grand River to do the sociological part of the project. We observed the amount of people who gave us negative reactions or stared. The first week was set as the control to base our results on. When taking the Hamilton test again at the end of the week, the average increased to 13.3. Frustration of mobility was starting to arise which may have caused the increase of depression. In addition, the depression could have been getting worse due to social aspects. We predicted many stares due to curiosity and more adverse reactions the further we got from Holmes. Brody was where the most people were observed staring, these students gave judgmental looks as well as made negative comments. Around Holmes this was noticed less. This could be due to people knowing it is for a Lyman Briggs class or were having to live with their disease as well. We did the fitness test again as well. We placed dramatically lower in the percentile of physical activity. Due to stiff joints it was harder to run and increased our time by over 10 minutes. For pushups we could not bend our elbows so our numbers were all lower than 5. The average for the second week of testing was in the 15th percentile. For the third week our disease symptoms progressed by having vision impairment. Getting the full affect of someone who lives with AlpersÕ disease correlated with the severity of depression. When we took the Hamilton test for the third time at the end of the week, our score averaged 15.2. This score is having a positive correlation with the number of people who exhibited staring. With the constant stares and the frustration with not being able to see the area around was, as well as the upcoming pain from the stiff joints explains why our depression is increasing. Moreover, the ability of partial blindness made us trust our peers and others around us. As for taking the physical test with the beginning of deterioration of our muscles, we were placed in the 5th percentile. The physical test consisted of walking, instead of running, which was lead by one of the other members due to vision impairment. Also, this made doing the other activities very difficult. For the fourth week, our disease progressed to the fullest effect of not being able to walk at all in addition to the other symptoms. A wheel chair was added which made transportation even more difficult. To leave buildings, wheelchair accessible exits had to be found, as well as going up and down ramps. Our predictions of frustration and desire to go back to a normal lifestyle were proved evident within this period. Our final depression score jumped all the way to 21.7. This score represents severe depression according to the Hamilton depression scale. Moreover, incorporating the wheel chair drew more attention to ourselves and increased our observed numbers. As for our symptoms reaching an all-time high, we dropped down to the 2 percentile for physical activity.

Future Directions

            Dr. NaviauxÕs study differed from our own in that they focused on more than just AlpersÕ disease as the result of the A467T mutation. For instance, it is wondered if the heterozygous A467T mutation is any less prominent than the homozygous A467T mutation when ran through PCR with the accurate primers. A question that was unable to be answered in Chan, Longley, and CopelandÕs work was the specifics of the mechanism by which the A467T mutation affects DNA polymerase activity. Since this mutation is the focus of the study the researchers are performing, it perhaps would be a good topic for future research. In addition, this research could continue by creating more primers and this time using the Yaku-Bonzyk method which would give us more specific bands. The Yaku-Bonczyk method designs the third base pair from the 3Õ end as an intentional mismatch that will never anneal to either mutant or wild-type DNA (Yaku et al, 2008). Our customized primers didnÕt work because our base-pairs were not specific which is why our bands were not specific. Using the Yaku-Bonzyk method could give us a better chance of getting specific binding and our primers binding successfully to amplify the A467T mutation. There is little research being done on AlpersÕ disease so it is still in its premature stages. To redesign our project, we would not do anything with POLG due to lack of knowledge about it. Finding a mutation that is more common may allows us to have a better understanding of the background behind it. 

 

Figures

 

 

Text Box: Figure 1: PCR amplification of the wild-type POLG gene from human IB-3 epithelial cells using published primers. Thermocycling conditions for all wells containing DNA included denaturation at 95¡ C for 30 sec, and elongation at 72¡ C for 45 sec. Annealing temperatures varied, wells 1, 3, 6, and 11 had an annealing temperature of 53.8¡ C, while wells 2, 5, 7, 9, and 10 had an annealing temperature of 50¡ C. Annealing times for all wells was 40 sec. 35 cycles of PCR were completed, and the gel was ran at 107 volts for 30 min. The amount of DNA, PCR buffer, and taq polymerase varied in concentration between reactions. While, the amount of forward and reverse primer, as well as dNTPs remained constant in each well. The concentration of water changed according to other materials to allow each cocktail to be 50 ul. Subsequently 10 ul of the 50 ul cocktails was added to each well. Lanes 4, 8, and 12 contain 8 ul of 1X KB ladder. Wells 1, 2, and 3 have a 2X concentration of PCR buffer, and 1 U/ul of activity of taq. Wells 5, 6, 7, and 11 all have 1X concentration of PCR buffer, and 2 U/ul of taq. In wells 9 and 10 there is a 2X concentration of PCR buffer, and 2 U/ul of taq. Wells 1, 7, 10, and 11 all have a concentration of DNA 3X that of the concentration in wells 2, 3, 5, 6, and 9. Lanes 2 and 3 exhibit results closest to what was expected, which was bands around 503 base pairs. Lighter bands are apparent around 500 base pairs. All of the lanes demonstrate smeared and faint bands, which indicate non-specific binding. The appearance of multiple bands is apparent in lanes 2 and 3, which indicate the possibility of the primers binding to other segments of the DNA. The large amount of product towards the end of the gel may also indicate excess primer. Moving across the gel to the right the lanes become fainter, as do the ladders. The separation of the ladder also becomes less distinguished. These changes could be due to the gel cooling improperly, and there not being an even distribution of agarose thus causing it to be more concentrated in some areas. This would limit the size of the product that could travel through the gel. Based on the results, it appears that the most successful product appeared when the amount of PCR buffer was doubled, as seen in lanes 1, 2, and 3. All three lanes demonstrate a brighter and more distinguishable product compared with lanes 5,6, 7, and 11 where taq was increased from 1 U/ul to 2 U/ul. Lanes 9 and 10, when both the concentration of PCR buffer and taq was increased, the results didnÕt work as well then when just PCR buffer was increased. The concentration of DNA seemed to have no effect on the product, since lanes 1, 2, and 3 all demonstrate similar results when the PCR buffer was increased despite the concentration of DNA.

 

 

 

 

Text Box: 1 2 3 4 5 6 7 8 9 10 11 12

 

 

 

 

Text Box: 1 2 3 4 5 6 7 8 9 10 11 12

 

 

 

 

 

 

 

Text Box:

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

AlpersÕ Disease Symptom Project (ADSP) Video- http://www.youtube.com/watch?v=GXX1QkUhCzk