PCR Based Identification of the R167W Mutation on the VHL Gene for Diagnosis of VHL Disease in IB3 Epithelial Cells

By: Jatinderpal Singh, Erin Smigielski, Victoria Braman

Abstract

Polymerase chain reaction (PCR) determined whether DNA samples from IB3 epithelial cells had the R167W mutation on the Von Hippel-Lindau (VHL) gene. This mutation causes the VHL tumor-suppressor gene to malfunction (Iwai et al, 1999). Based on similar PCR testing, this method was useful for accurately diagnosing patients with the VHL gene mutation (Hasani-Ranjbar et al, 2009). By adding specific primers to wild-type DNA samples, such as 3’-GTGCAACAGGCCTCGGGA-5’ (reverse) and AAGAGTACGGCCCTGAAGAA (forward), DNA was amplified and analyzed using agarose gel electrophoresis. The presence of bands were to be observed at 447 base pairs, the distance between the forward and reverse primers. This yields a positive test for the mutation (Hasani-Ranjbar et al, 2009). To familiarize subjects with real-life experiences of a patient living with VHL, a diet common to those going through chemotherapy was followed. Subjects took the BAI and BDI-II, two psychological tests designed to measure anxiety and depression. We hypothesized subjects would show symptoms of depression during the diet due to the lack of tryptophan from decreased protein and lactose consumption (Doyle et al, 2006). Statistical analysis of the BDI-II resulted in a p-value of 0.06 and BAI p-value of 0.61; for this measure, the results failed to reject the null hypothesis (diet has no effect on mental health). These results suggest minimal psychological effects due to a chemotherapy diet. No bands were observed after conducting PCR and gel electrophoresis. Altogether, the findings of this experiment are important in advancing genetic testing for diagnosis of individuals with VHL.

Figure

Figure 4. Gel electrophoresis results of wild-type DNA with Yaku primers run with LB buffer at 292 Volts. Thermocycling conditions varied in annealing temperatures. Initial denaturation occurred for 5 minutes at 95°C, denaturation occurred at 95°C for 30 seconds, annealing occurred at 50°C, 52°C, 57°C, and 60°C for 45 seconds, elongation occurred at 72°C for 30 seconds, and final elongation occurred at 72°C for 5 minutes to conclude the assay; 35 cycles were run for all PCR assays. Nonspecific binding was evident in all lanes but was most prevalent in lane 4, lane 5, and lane 6. Results suggested a lower annealing temperature (between 51°C and 57°C) be used to reduce nonspecific binding. Lane 1 and lane 7 contained 1 kb molecular ladder.

Discussion

Experiment Summary

Research performed by the United States Department of Health and Human Aid reveals Von Hippel-Lindau disease to be an autosomal dominant disorder characterized by the abnormal growth of tumors in both the central nervous system and the abdominopelvic region (Kondo et al, 2003). This is due to a mutation on chromosome three in the VHL tumor-suppressor gene (pVHL), which fails to suppress the growth of tumors when not functioning properly (Iwai et al, 1999). The R167W mutation, one of more than 300 possible VHL mutations, is a specific point mutation on exon three of the VHL gene at the 499 base pair (Hasani-Ranjbar et al, 2009). This mutation involves the single base pair substitution of cytosine with thymine at the 167^th amino acid, which results in the replacement of Arginine with Tryptophan (Iwai et al, 1999). This incorrect amino acid and other mutations on the VHL gene cause pVHL to malfunction, leading to abnormal tumor growth. The designed procedure will aide in the diagnosis of this specific VHL gene mutation in a patient using PCR, as was done in a similar study by Pastore to screen for VHL in children (Pastore et al, 2003). We hypothesized that an accurate PCR assay for this mutation can be achieved with two primers, complimentary to either mutant or wild-type DNA, and one forward primer which will anneal to both mutant and wild-type DNA (Pastore et al, 2003). We predicted primers designed for wild-type DNA would produce a band at the 445bp mark, and primers for mutant DNA having a band at 447bp. The difference is due to the mutant primer being 2 base pairs longer than the wild-type primer. Proper annealing temperatures were calculated and a PCR cocktail was designed to allow for annealing of the primers. Our ultimate findings did not reveal the presence of either band size after conducting gel electrophoresis.

Genomic Preparation

Purified genomic DNA was extracted from IB3 epithelial cells for use in all assays conducted. Each cocktail had a concentration of 2.55 ng/µL of purified DNA in the 1µL added to the cocktail. In the final PCR assays run the concentration was increased to 5.1 ng/µL (2µL in the PCR cocktail), which is a more optimal concentration (Etlik et al, 2007). This increase was expected to produce bands using wild-type primers however none were ultimately observed.

PCR

We predicted all primers would bind to their respective base pairs and a band would appear at 428 base pairs for the wild-type DNA when using the primer which anneals to wild-type DNA, in which a negative test will indicate the presence of the R167W mutation (Hasani-Ranjbar et al, 2009). The same is true for the mutant DNA; when a primer which anneals to mutant DNA is mixed with mutant DNA, a positive test will indicate the presence of the R167W mutation with a band appearing at 445bp (Hasani-Ranjbar et al, 2009). This is based on the base pair change of cytosine to thymine (Pastore et al, 2003). The presence of a 447 base pair band in the known mutant DNA would have strongly supported the hypothesis that the primers designed are a viable test for the R167W mutation. Previously published research has had success in detecting the pVHL gene mutations using PCR and gel electrophoresis, particularly by Yves D. Pastore and his team to screen for the 598bp cytosine to thymine mutation and the 388bp guanine to cytosine VHL mutations in children (Pastore et al, 2003). However, no bands were detected. Bands appearing below the 100bp mark indicate when primers are too complementary and have annealed to each other, also known as primer dimer. There was primer dimer and ample nonspecific binding observed. This indicated an issue with primers (Brownie et al, 1997). Two sets of primers were ordered throughout the experiment. The first set included a forward, reverse and mutant primer. The second set was ordered using a method outlined by H. Yaku (Yaku et al, 2008). The forward primer previously designed was kept, however new mutant and reverse were designed using the Yaku method. Bands were expected to be the same base pair length as previously determined. However, these primers did not yield bands as hypothesized. Mutated genomic DNA was not obtained to perform PCR on using either set of primers.

Sociological Examination

In order to better understand the mental state of a patient with VHL, the group decided to live like an individual going through chemotherapy, since cancer is a common symptom of VHL gene mutations (Kaelin, 2002). Symptoms were hypothesized to be the result of a lack of protein, lactose and tryptophan, which reduces alertness and has been linked to depression (Moja et al, 1988). Factors influencing this predicament may only be hypothesized, such as personal illness or positive changes in sociological/environmental settings. According to data gathered from the BAI and BDI-II exams, no significant changes in subject anxiety or depression levels exist. The calculated p value for the BAI was 0.61 and the the p value for the BDI-II exam was 0.06. Because both p values are above 0.05, both exams were insignificant. Although the results were insignificant, we were still able to better understand the dietary limits a chemotherapy patient must face by experiencing this lifestyle for a two week period.

Troubleshooting

There were some problems encountered during this experiment. The first set of primers used for amplification were seemingly ineffective. The primers arrived at the laboratory undiluted and upon preparing them for use, too much water was added. This over-diluted the primers causing several problems. The amount of primer added to the PCR cocktail was insufficient due to the over-dilution. An attempt to correct the problem was made by adding 40µL of primer into the cocktail assuming they would anneal. However, this was ineffective due to the disruption in concentration. Taq polymerase requires magnesium ions to function properly. This is perhaps the most important aspect to optimize in the cocktail (Sambrook, 1989). However the diluted primers possibly interfered with the concentration of the entire cocktail, the magnesium in particular. This would not allow PCR to function properly and would not show bands where expected. One possible solution would be to centrifuge the primers to reconcentrate them at the bottom of the vial. Another problem that was encountered was ethidium bromide concentrations in the gel. Originally 1.5µL was added to each gel for illumination. However, the gels began only illuminating on the top half while the rest was too dark to read bands properly. After reducing the amount to 1.0µL, gels began lighting up properly.

Future Directions

There are several aspects of research that could be continued if there were no time constraints. Ordering primers using the Yaku approach sooner in the experiment would be beneficial. Reconcentrating the original set of primers and running PCR to test for amplification would also have been helpful to eliminate the possibility that the primers were completely ineffective. Gels that were improperly illuminated indicated a need for change in amount of ethidium bromide used. By altering the amount used in the gels earlier in the experiments, gels would be easier to read possibly showing bands and/or primer dimer. Obtaining mutated genomic DNA for use with mutant primers would have also been beneficial. Due to time and the availability of the 499bp mutation this was not possible. Running mutant primers with mutant DNA to obtain bands at the 447bp mark would warrant each experiment even more of a success. Another technique that could be used is the Southern Blot technique. This would allow for determining the actual sequence of the DNA fragment. Using gel electrophoresis to separate DNA fragments, sequences can be determined from complementary RNA (Southern, 1975). This technique would be extremely useful. By using Southern Blot, the sequence being used could be confirmed. It would also ensure that the primers designed would anneal because the sequence was determined by this. Southern blot being used in the beginning of the experiment would have saved time in designing and purchasing primers, as well as a more accurate experiment. Primer design would also be a source for change in the future. Altering distance between primers for a different band size may be useful, as well as using the Yaku approach may have produced better results from start of the experiment.