Identification of GM Zea mays by Detection of Bacillus thuringiensis Cry1A Gene and CaMV 35S Promoter Using PCR

By: A41999563, A41914348, A42127766, A42180316

LB 145 Cell and Molecular Biology

Tuesday 4:00 PM

David Malakauskas, Natalie Palumbo, Kelsey DeLand

19 April 2011

http://web.me.com/julienguyen1/Site_3/Research_Paper.html

Title page written by: A41914348

Revised by: A42180316

Finalized by: A41999563

Abstract

Written by: A41914348
Revised by: A42180316
Finalized by: A41999563

GM crops differ from base gene crops because of the insertion of specific genes in the DNA. One of the most common genes inserted into Zea mays is the Bt gene, along with the 35S promoter, causing the plant to produce the Cry1A protein (Adnan, 2010). DNA was extracted from genetically modified (GM) Zea mays seeds as well as non-GM seeds using the protocol from The National Institute of Agricultural Science and Technology (Kang et al, 1998). DNA was also extracted from E. coli that contained the Cry1A plasmid. A PCR test was designed to validate the Cry1A primers by showing successful amplification of the plasmid DNA. A PCR test was designed to validate the Zea mays DNA extraction by showing successful amplification of the sucrose transporter1 gene using the sucrose transporter1 primers. After the validation, the Zea mays DNA was tested for genetic modification with PCR cocktails containing the Cry1A primers and the 35S promoter primers. These specific primers were designed to correspond to the inserted DNA and temperatures were calculated to ensure proper environments for the DNA strands to denature, anneal, and extend. The PCR assays were expected to determine whether the sample of Zea mays contained the Cry1A gene or the 35S promoter because the primers would only copy the DNA segments if they contained those variations (Saiki et al, 1988).The PCR test performed with the Cry1A primers showed amplification of the plasmid DNA at approximately 591 base pairs, providing evidence that the Cry1A primers and PCR conditions were effective. However, the primers did not amplify the Cry1A gene in any Zea mays DNA. The 35S promoter primers and the sucrose transporter1 primers also showed no amplification of the Zea mays DNA.

Each researcher followed a non-GM diet. Each diet slightly differed because food items in the individual’s GM diet were substituted with non-GM food items. Price comparisons were made between each GM and non-GM diet. Advancements in genetic engineering have been a significant factor in the increase of crop production. The designed PCR tests can be useful for determining if GM crops have pollinated crops that are desired by farmers to be non-GM.

Introduction

Written by: A41914348
Revised by: A42180316
Finalized by: A41999563

Organisms that are genetically modified have a foreign gene that is inserted in their gene sequence, which allows them to be advantageous in a variety of ways because of the many benefits they offer (Lee et al, 2006). The Bacillus thuringiensis (Bt) gene, extracted from soil inhabiting bacteria, is inserted into gene sequences of crops to alter their physical characteristics (Adnan, 2010). GMOs first appeared as herbicide-tolerant or insect-resistant crops for producers (Lee et al, 2006). These traits appeal to many farmers who are trying to meet the demands of a growing worldwide food market. Zea mays, also known as corn, is one of the many organisms that have been genetically modified by the insertion of the Bt gene (Adnan, 2010).

There are many reasons why genetically modified corn is on the rise, one being that genetically modified corn helps kill pests (Lee et al, 2006). In the past, large amounts of harmful pesticides were used on crops to kill insects, which would otherwise feed on the plant.  Many of these pesticides were not only harmful to the environment, but a major health risk for farmers that were forced to use the chemicals.  Insects soon began to grow resistant to the pesticides being used and they became less effective against insects while being equally as harmful to the environment and humans.  The use of GMOs and the Bt gene was effective in controlling pests while staying harmless to humans. The Bt gene produces protein crystals that bind to the mid-gut of insect larvae, causing cells to burst due to water imbalance and the insect to die (Adnan, 2010). The insertion of the Bt gene poses a great advantage for farmers with GM crops because they can refrain from spraying additional pesticides onto their crops.

The protein that codes from the Bt gene is called the Crystal delta-endotoxin protein, also known as the Cry protein (Adnan, 2010). There are many forms of this protein that are exhibited in genetically modified crops, however, one of the most common variation is the Cry1A protein (James et al, 2003). There are a variety of methods that are used to insert the Bt gene into the DNA sequence of corn. The most common technique involves a gene gun, which bombards the Bt gene into the Zea mays DNA. With the help of a promoter, the gene segment enters the corn DNA and produces the Cry1A protein (Adnan, 2010). An objection that might inhibit the research is that the Cry1A protein is only one specific variation of the many Cry proteins that are in GM organisms.

The Cry1A primers and the 35S promoter primers will amplify DNA from GM corn and will not amplify DNA from non-GM corn. All of the Zea mays samples are predicted to test positive for the Sucrose gene because sucrose is present in all genetically modified and non-genetically modified Zea mays (Wippel, 2011). The Bacillus thuringiensis DNA is predicted show positive results when it is applied with the same primers used on the Cry1A protein and Bt gene (Adnan, 2010).

Methods

Written by: A41999563
Revised by: A42127766
Finalized by: A42180316

Designing Primers

          Prior to performing the PCR assay, oligonucleotide primers were designed for each gene sequence. A forward primer, Cry-Primer1 (21-mer), and a reverse primer, Cry-Primer2 (21-mer), were designed for amplification of the Bacillus thuringiensis Cry1A gene. The nucleotide sequences were 5’- GTTGATAGCTTGGACGAAATT -3’ and   5’- GAATTCTCGAGTTATTCGAGT -3’respectively. The Genbank Database was used to obtain the genomic sequence of the Cry1A gene (Franco-Rivera et al, 2004).
           A forward primer, S-Primer1 (21-mer), and a reverse primer, S-Primer2 (21-mer), were designed for amplification of the cauliflower mosaic virus (CaMV) 35S Promoter. The nucleotide sequences were 5’-AGGCCATCGTTGAAGATGCC-3’ and 5’-TACCCTGTCCTCTCCAAATGA -3’ respectively. The GenBank database was used to obtain the genomic sequence of the CaMV 35S promoter (Morisset, 2009).
           A forward primer, Z-Primer1 (21-mer), and a reverse primer, Z-Primer2 (21-mer), were designed for amplification of the Zea mays sucrose transporter1 gene. The nucleotide sequences were 5-’GTTCATCCTCTACGACACCGA-3’ and                           5’-CTCGTTTCGCCCGCTTCTTAT-3’respectively. The GenBank database was used to obtain the genomic sequence of the sucrose transporter1 gene (Wippel, 2009).
           The following formula was used to calculate the theoretical melting temperatures: Tm=4°C x (#G’s + C’s in the primer) + 2°C x (# A’s + T’s). These melting temperatures were found: Cry-Primer1 (21-mer) and Cry-Primer2 (21-mer) = 58°C, S-Primer1 (21-mer) = 62°C and S-Primer2 (21-mer)= 62°C, Z-Primer1 (21-mer) 64°C and Z-Primer2 (21-mer) = 64°C (Kibbe, 2007). These calculations supported an annealing temperature of 54°C for the Cry-Primers, 58°C for the S-Primers, and 60°C for the Z-Primers.
DNA Isolation
            A Cry1A plasmid was provided by Kelly Zarka from the Soil and Plant Nutrition Lab in the Department of Crop and Soil Sciences at Michigan State University, E. Lansing, MI.
           The DNA from the Cry1A plasmid was extracted by following the protocol from the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, Wisconsin). To produce a cleared lysate, 5ml of 24 hour E. coli culture with ampicillin, which contained Cry1A plasmid, was placed in a test tube and centrifuged at 5,200 rpm for ten minutes at room temperature (20-25°C) to produce a pellet. The pellet was resuspended with 250µl of Cell Resuspension solution. Then 250µl of Cell Lysis Solution was pipetted into the test tube and mixed by inverting four times. Next, 10µl of Alkaline Protease Solution was pipetted into the test tube and mixed by inverting four times. 350µl of Neutralization Solution was pipetted into the test tube and mixed by inverting four times. The test tube was then centrifuged at 5,200 rpm for 10 minutes at room temperature (Promega, Madison, Wisconsin).
           To bind the plasmid DNA, a spin column was inserted into the collection tube and the cleared lysate was decanted into it. The collection tube was centrifuged at top speed for a minute at room temperature. The flowthrough was discarded and the spin column was reinserted into the collection tube (Promega, Madison, Wisconsin).
           The washing process required 750µl of Wash Solution, which was pipetted into the test tube and was centrifuged at top speed for one minute. The flowthrough was discarded and the spin column was reinserted in to the collection tube. 250µl of wash solution was pipetted in to the collection tube and the flowthrough discarded. The test tube was centrifuged at top speed for two minutes at room temperature (Promega, Madison, Wisconsin).
           To elute the DNA, the spin column was transferred to a 1.5ml microcentrifuge tube and 100µl of Nuclease-Free Water was pipetted in to the spin column. The microcentrifuge tube was centrifuged at top speed for one minute at room temperature (Promega, Madison, Wisconsin). 10µl of DNA was collected from the microcentrifuge tube and placed in a test tube to be used in the PCR test. To validate the DNA extraction, a sample was run on the spectrometer against distilled water. The DNA concentration was calculated. If DNA was present, the PCR test was then run.
DNA Extraction

Hamlin Farms in South Haven, Michigan, provided seven Zea mays seeds that were either GM or non-GM. The DNA from each Zea mays sample was extracted using the QIAGEN DNeasy Plant Mini Kit (QIAGEN, Valencia, California). The Zea mays sample was froze using liquid nitrogen, then ground into a fine powder using a mortar and pestle. A 0.2g sample of the Zea mays was then transferred to a 15 ml centrifuge tube. Next, 5 ml buffer AP1 that was preheated to 65°C and 10 µl RNase (100 mg/ml) were added to the 15ml centrifuge tube and vortexed vigorously until no tissue clumps were visible. The mixture was incubated in a hot water bath for ten minutes at 65°C. The tube was inverted 2 to 3 times in order to lyse the cells. Next, 1.8 ml of buffer AP2 was added to the lysate, mixed, and then incubated for ten minutes on ice. The lysate was centrifuged at 3000 to 5000 xg for five minutes at room temperature. The supernatant was decanted into QIAshredder Maxi spin column and centrifuged at 3000 to 5000 xg for five minutes at room temperature. The flowthrough was transferred to a new 1ml tube, without disturbing the pellet. 1.5 volumes of buffer AP3/E was added to the cleared lysate and vortexed. The sample was pipetted into the DNeasy Maxi spin column placed in a 1 ml collection tube and centrifuged at 3000 to 5000 xg for five minutes at room temperature. The flowthrough was discarded. 12 ml buffer AW was added to the DNeasy Maxi spin column and centrifuged for ten minutes at 3000 to 5000 xg to dry the membrane. The flowthrough was discarded. The DNeasy Maxi spin column was transferred to a new 1 ml tube and 0.75 – 1.0 ml buffer AE was pipetted directly into the DNeasy Maxi spin column membrane. This was incubated at room temperature for five minutes then centrifuged for five minutes at 3000 to 5000 xg to elute. Another 0.75 – 1.0 ml of buffer AE was added and the elution step as described previously and was repeated. This procedure was repeated for each corn sample.

Polymerase Chain Reaction
           Four PCR based tests were designed using the three sets of primers. Test #1 (Cry-primers) and Test #2 (S-Primers) were designed to identify GM Zea mays. Test #3 (Cry-primers) was designed as a control to determine if the Cry-primers identified the Cry1A gene in the Cry1A plasmid. Test #4 (Z-primers) was designed as a control to validate the Zea mays DNA. Each test required a combination of 40µl H2O, 5µl 10X PCR buffer, 1µl forward and reverse primer, 1µl Taq polymerase, and 1µl DNA template to be pipetted into a PCR tube lodged in ice. Each sample was separately placed into the Labnet thermacycler to run the PCR. The temperature was set to 95°C for the five minute initial denaturation stage. The temperature remained at 95°C for the 30 second denaturation stage. The temperature was decreased to the annealing temperature required by each set of primers (Cry-Primers 54°C, S-Primers 58°C, Z-Primers 60°C) for the 30 second annealing stage. The temperature was raised to 72°C for the 60 second extension stage. The temperature remained at 72°C for the seven minute final extension stage. The denaturation stage, annealing stage, and extension stage were repeated 35 times.

Gel Electrophoresis

The base pair length of the PCR amplified DNA products was determined through agarose gel electrophoresis. A gel was formed by mixing 0.4 grams of 1% agarose solution of agarose powder with 40 ml of 1X TBE buffer in a flask and heating for 45 seconds in the microwave. After heating, 1µl of ethidium bromide was added to the solution. It was then poured into a mold. A comb was inserted at the base of the gel and it was allowed to cool, the comb was then removed. The gel was placed in the electrophoresis chamber and covered with TBE. Each PCR product was mixed with 1µl of 6X loading dye and 5µl of the product was pipetted into lanes #2-5. Lane #1 contained 5µl of the 1Kb Plus DNA Ladder (Invitrogen, Carlsbad, California), which showed the targeted regions of DNA in each primer, which was used to determine the positive and negative results for the PCR. The gel was then connected to the charger and run at 80V for 30 minutes.

Social Experiment
           Each person spent one week eating only non-GM foods.  The food they ate were alternatives to the GM foods they normally eat.  The cost comparison between the non-GMO groceries and the normal groceries was statistically analyzed and graphed.

Also, Harold Hamlin, a farmer, from Hamlin Farms in South Haven, Michigan who grows GM crops and sells GM and non-GM seeds was interviewed. Some of the factors discussed were crop yield per acre, pesticide use per acre when using GM crops and when using non GM crops, cost of GM seeds compared to non-GM seeds, and how switching to genetically modified crops has affected his income.  Some of the factors discussed with the non-GM farmer included crop yield per acre, cost of non-GM seeds, cost of labor and use of pesticides. The information obtained during the interview with Mr. Hamlin was used for further understanding of the use of GMOs in farming.

Results

Written by: A41999563
Revised by: A41999563
Finalized by: A41914348

    Gel electrophoresis was performed on the isolated DNA from the Cry1A plasmid.
The Cry1A gene is 1786-bp long; therefore the band at the 1800-bp marker confirmed the DNA was isolated (Figure 1).  
    After extracting the plasmid DNA from the E. coli culture and performing a successful gel electrophoresis, spectrometry was used to quantify the results. The spectrophotometer was set to find the ratio of absorbencies of 260 nm UV light and 280 nm UV light, which were used determine the concentration (mg/ml) of DNA in the sample. The Bt plasmid, extracted from the culture was used in PCR with the Cry1A primers.                             The sucrose primers were tested on the Zea mays samples as a positive control.
There was unsuccessful amplification of the Zea mays DNA using the sucrose primers. The sucrose primers were expected to anneal to all samples of Zea mays DNA because sucrose is present in all Zea mays (Figure 2).
    In order to test whether a Zea mays sample was genetically modified or not, the 35S promoter primers were used on the corn sample. If the DNA was successfully amplified using those primers, the corn tested was genetically modified. Both the presence of the Cry1A protein and 35S promoter were indications of genetically modified corn. The Cry1A primers did not successfully amplify the Zea mays sample, resulting in no bands on the gel (Figure 3).  The 35S promoter primers did not successfully amplify the Zea mays sample, and no bands appeared on the gel (Figure 4).

The price comparison between the GM food products and non-GM food products were compared (Figure 5). The average price of the nine GM food products was $2.09. The average price of the nine non-GM food products was $2.83. This data shows that a diet including GM food precuts is approximately 26% cheaper.

Discussion

Written by: A42180316
Revised by: A41914348
Finalized by: A42127766

Genetically modified crops offer a variety of potential benefits, including increased crop yield, more effective pesticide use, and lower prices for consumers and increased nutrient content in GM foods. (Chapman et al, 2006). Genetically modified crops have a foreign gene that is inserted into their gene sequence that can be advantageous in multiple ways (Lee et al, 2006). The Bt gene that is inserted into crops, more specifically, Zea mays, allows farmers to significantly reduce the amount of pesticides needed. The Bt gene extracted from a soil inhabiting bacterium, Bacillus thuringiensis, encodes for a protein called Cry1A, which binds to the gut of the insect causing it to die. This is beneficial for GM farmers because they will no longer need to use pesticides to eradicate pests from their crops.

Three different primers were used to test for the presence of GM corn during PCR. The first primer set was used to detect the sucrose transporter1 gene within the corn. The resulting band would be present around 744 bp. The next primer set was used to test for the Cry1A gene sequence. This primer set would result in a band of approximately 617 bp.The final primer set tested for the S35 promoter in the corn samples. This test would produce a band of approximately 291 bp. The bands were measured by comparison to the 1Kb Plus DNA Ladder.

For the social aspect of this experiment, Harold Hamlin, a farmer from Hamlin Farms in South Haven was interviewed to better understand GM crops and why they are used today. Through this research, we gained a greater insight on the background of our research. One thing we learned was that genetically modified Cry1A seed is half the price of the refuge seed. The refuge seed is not genetically modified which prevents Cry1A gene resistance. From a personal standpoint, Harold saves ten dollars per acre with GM corn, he saves $17000 per year. The savings allows him to increase his annual yield up to 20%.

The Cry1A primers and the 35S promoter primers will amplify DNA from GM corn and will not amplify DNA from non-GM corn.  All of the Zea mays samples are predicted to test positive for the sucrose gene because this gene is present in all genetically modified and non genetically modified Zea mays (Wippel, 2011). The Bacillus thuringiensis DNA is predicted to show positive results when it is applied with the same primers used on the Cry1A protein and Bt gene (Adnan, 2010).

The results for our hypothesis regarding the amplification of the Zea mays DNA using the designed primers were inconclusive. One band was produced using Cry1A primers on the Bt plasmid DNA.  No bands were produced when the Cry1A primers were used on the Zea mays samples.  Sucrose transport primers on the Zea mays samples produced no bands.  The 35S promoter primers with the Zea mays samples also resulted in no bands.

The results for our hypothesis regarding the price comparison support our hypothesis that GM foods were more expensive than non-GM foods when bought at the local grocery store.

Troubleshooting the methods and procedure was required for a successful PCR. Some troubleshooting that occurred include lowering the annealing temperatures for each primer set and diluting the DNA concentrations. For the Bt plasmid DNA with the Cry1A primers, bands were produced. However, the bands for the plasmid DNA were much brighter than the bands for the Bt DNA with the Cry1A primers. Therefore, the DNA concentration was diluted in hopes of brightening the Cry1A band. This was unsuccessful. For the Sucrose primers with the Zea mays DNA, the annealing temperatures were adjusted from 62°C to 48°C. This produced no visible bands at any temperatures. For the Cry1A primers with the Zea mays DNA, the annealing temperatures were adjusted from 58°C to 43°C. No visible bands were produced from these changes. For the S35 Promoter primers with the Zea mays DNA, the annealing temperature was changed from 64°C to 52°C. This caused no noticeable results in the gel. The results neither supported nor refuted our hypothesis.

Weaknesses in experimental design include focusing on too many tests at once and using corn samples that might have not contained the Cry1A mutation. During the research, one of the main weaknesses was the fact that multiple PCR tests were focused on at once instead of focusing on one main test. If more time was spent with one test, more troubleshooting could have been done and amplification of the desired product might have been reached. Another weakness experienced during this experiment was that the Zea mays samples used might not have contained the Cry1A protein. More time could have been spent locating Zea mays samples with the specific Cry1A mutation in order to increase the chances of the primers annealing to the extracted DNA.

            In addition to the research performed inside the laboratory, further investigation into the world of GM Zea mays took place. An interview was conducted with a farmer that grows GM Zea mays. Information about why GM foods are beneficial was provided. An experiment was also designed to compare the prices of GM foods to non-GM foods at the local Meijer’s in Okemos, Michigan. Our results showed GM foods are much more expensive when compared to non-GM foods.

To continue the research on genetically modified Zea mays, another PCR assay could be designed to test for other genetic modifications in Zea mays.  The Cry1A protein is not the only modification used today in GM Zea mays. Another example of further research could be done on the extent of genetic modification in today's food supply and how it affects the lives of the consumer. Testing foods eaten everyday for genetic modification could do this. Research is being conducted to modify certain Zea mays genes that are responsible protein production causing increased crop yields and nutritional value (Lee et al, 2006). This research has also extended into other widely cultivated crops.

References

Written by: A42180316
Revised by: A41914348
Finalized by: A42127766

Adnan, Amna. "Bt Corn: Methods, Mode of Action and Benefits." Biotech Articles. (2010)     

Chapman, Mark A., and John M. Burke. "Letting the Gene out of the Bottle: the             Population Genetics of Genetically Modified Crops." New Phytologist 170.3 (2006): 429-43.

Franco-Rivera, A., G. Benintende, J. Cozzi, VM Baizabal-Aguirre, JJ Valdez-Alarcón,      and JE López-Meza. "Molecular Characterization of Bacillus Thuringiensis Strains from Argentina." ANTONIE VAN LEEUWENHOEK 86.1 (2004): 87-92.

James, Delano, Mary-Anne Schmidt, Erika Wall, Margaret Green, and Saad Masri.           "Reliable Detection and Identification of Genetically Modified Maize, Soybean, and Canola by Multiplex PCR Analysis." Journal of Agricultural and Food Chemistry 51 (2003): 5829-834.

Kang, H.W, Y. G. Cho, U. H. Yoon, and M. Y. Eun. "A Rapid DNA Extraction Method    for RFLP and PCR Analysis from a Single Dry Seed." National Institute of             Agricultural Science and Technology 90th ser. 16.1 (1998): 90.

Lee, S.H., D.M. Min, and J.K. Kim. “Qualitative and quantitative polymerase chain         reaction analysis for genetically modified maize MON863”. Journal of Agricultural and Food Chemistry 54 (2006): 1124-1129.

Morisset, D. "Zea mays transgenic Cauliflower mosaic virus 35S promoter region."           National Center for Biotechnology Information. (2009) U.S. National Library of                Medicine.

Saiki, R. K., D. H. Gelfand, S. Stoffel, S. J. Scharf, and R. Higuchi. "Primer-

Directed Enzymatic Amplification of DNA with a Thermostable DNA Polymerase" Science 239.4839 (2009): 487-491.

Wippel, K. 2010. "Zea mays sucrose transporter1 (umc2347), mRNA." National Center         for Biotechnology Information. U.S. National Library of Medicine.