Diagnosing the PS1-E280A mutation in human brain cell of Alzheimer’s patients
using PCR and electrophoresis
Team Picnic:
Julie Adamo, John Cochrane, Leah Jackson and Casey Spooner
Abstract
Alzheimer’s disease can be caused by a point mutation that deters Presenilin-1 protein production. The E280A mutation is located at the 280th codon of the PS1 gene and changes glutamic acid (GAA) to alanine (GCA), causing excess beta-amyloid peptide formation, leading to brain deterioration (Lopera, 1997). It was hypothesized that by using PCR to amplify a 822 bp region around the missense mutation would identify the presence of the E280A mutation in a DNA sample, diagnosing Alzheimer’s disease (Lopera, 1997). The resulting PCR product was analyzed using agarose gel. This assay was hypothesized to be able to diagnose the presence of the E280A mutation based on which primers were used with the DNA sample because the presence or absence of a band at 822 bp on a gel would confirm or deny the mutation’s existence (Kwok 1997). The results of this assay are inconclusive because an 822 bp band was not successfully obtained. New primers have been designed in order to obtain successful results. This offers an easy, fast, and inexpensive way to diagnose Alzheimer’s. A sociological experiment was done concurrently with the assay to understand the effects of the disease. Investigators used restrictive braces to experience inhibited motor skills, and experienced confusion by being in an unknown location and needing to find their way back to a known location. A p-value of 0.01162 was obtained using a T-test, less than 0.05, showing that the data was statistically significant and the results are valid.
Discussion
Alzheimer’s disease is the most common form of dementia with an estimated 24 million patients worldwide (Mihaescu et al, 2010, Arango-Lasprilla et al, 2007). Mutated proteins begin overproducing amyloid beta peptides, and the patient gradually begins showing symptoms for Alzheimer’s (Gomez-Isla et al., 1999). Many mutations cause this disease, with the most common being the E280A mutation. This experiment attempts to discover an assay that can screen DNA samples for the E280A mutation. It was hypothesized that primers would either present or prevent a band in gel electrophoresis from forming and this could be used as an appropriate diagnostic assay to determine if a DNA sample had the E280A mutation, resulting in Alzheimer’s disease.
In order to investigate some of the secondary effects of Alzheimer’s symptoms, all four members of this lab group experienced several symptoms of Alzheimer’s, including memory loss, confusion, and decreased motor abilities. Afterwards, the subjects gave testimonies about how Alzheimer’s symptoms affected their daily lives. To quantify the findings, all the events were timed impaired (recreating Alzheimer’s) and unimpaired. The results of the timings were compared with a T-test. It was hypothesized that the impaired events, recreating Alzheimer’s, would take a longer time than the unimpaired ones because the symptoms of Alzheimer’s negatively affect everyday activities.
A diagnostic assay used to determine the presence of the E280A mutation in human DNA samples would be particularly helpful in providing earlier diagnosis for patients with Alzheimer’s disease. However, some studies have discovered negative side effects in having patients undergo genetic testing to diagnose Alzheimer’s (Ashida et al., 2010). A similar research group found that when patients were informed that they were genetically predisposed for Alzheimer’s, they often exhibited decreased psychological well-being, shown by higher depression scores (Ashida et al., 2010). While this does pose some evidence against the use of genetic testing, the power of knowing and adding preventative diet and exercise to daily activities outweighs the possible negative side effects. In addition, earlier diagnosis of Alzheimer’s could lead to patients increasing their insurance coverage (Taylor et al., 2010).
To determine if a sample of DNA was wild type or mutant, it would depend on which pair of primers was added in the reaction cocktail for PCR. If an unknown sample was combined with Primers 1 and 3 (which were designed to anneal to mutant DNA) and a band was produced, that would signify that the unknown sample has the mutation (Figure 1). Otherwise, if combined with Primers 1 and 3 and no band was produced (assuming correct methods), that would signify that the sample does not have the mutation. This was the methodology that was used to create a diagnostic assay to diagnose the E280A mutation. Theoretically the assay should function; however, there are numerous variables involved in PCR and gel electrophoresis that can impair its functionality. In order to ensure that PCR worked in the case of an absent band, a positive control was used. Two other primers were designed to anneal to a 483 bp region at all times, independent of whether the sample was mutated or not.
A human cultured cell was used as the wild type DNA sample. DNA samples may contain impurities or extra substances, such as proteins, that can affect the amplification process and create a false negative (Degrave et al., 1994). This is a problem because the results can be interpreted incorrectly leading to poor experimentation (Degrave et al., 1994). The cell was lysed, and run through a 0.8% agarose TBE gel at 130V (Figure 2a). As seen in figure 2a, lanes 2, 3, and 4 all show an illumination in the wells of the gel, which was where the DNA was loaded. This illumination indicates that the DNA was purified because impurities would not be illuminated. The reason the well was illuminated and that a band was not formed is because the DNA had a large amount of base pairs, and therefore was not small enough to travel through the agarose gel. To further ensure the DNA was not contaminated, the ratio of DNA to protein was found to be 1.167. A value larger than 1 signifies that there is more DNA than protein, providing further evidence that the DNA was purified.
Mutant DNA with mutant primers, control primers, and wild type primers, were all run through PCR machines at 51, 53, 54 and 55°C (Figure 3). Lane 5 shows that the mutant primers annealed to the DNA the best at 55°C because there is a band present around the predicted 822 bp area. Also, lane 2 shows that the control primers annealed the best at 51°C because there is a band present at the predicted 483 bp region. There is error in this gel because the mutant and wild type primers should not have both been placed in the reaction cocktail. They were competing for the same spot on the DNA strand, which is why there is smearing. In the future, only a wild type or mutant primer pair should be placed in the reaction cocktail. Further, there are ominous “clouds” at the bottom of the 4 middle lanes. These were predicted to be unused primers, DNTPs, and DNA, and future gels evaluated this theory.
To find an annealing temperature that would simultaneously work for both the control and mutant/wild-type primers, lower temperatures were tested (Figure 4). No bands resulted however, and clouds at the bottom of each lane were present. Lane 3 shows that the control did anneal to the wild type DNA because there is not a cloud at the bottom of the lane, which indicates that all the DNA, DNTPs, and primers were used; however, instead of the predicted 483 bp band, a large “brick” showed. From this result, it was predicted that this temperature could be the basis of experimentation because there were bands in the appropriate places, even if the results were undesired. PCR products were also run at higher temperatures, but nothing conclusive was drawn, reinforcing that we need to try more annealing temperatures (Figure 4). Lane 11 showed a band when wild type DNA was used with mutant primers. This was not predicted to work and future gels also were done to reevaluate this anomaly.
Continuing to evaluate annealing temperatures, wild type DNA was combined with either wild type or control primer sets at various temperatures (Figure 5A). Also, mutant DNA was combined with either mutant or wild type primer sets (Figure 5B). Nothing conclusive was discovered, and the mysterious clouds reappeared in both gels. Future gels continued to analyze these clouds. In lanes 7 and 6 of figures 5a and b, respectively, there were single bands located above the clouds. Since they are below the ladder, they are small and are therefore not the desired band, and could be a result of primer dimmer and nonspecific binding.
To analyze the mysterious clouds, reaction cocktails were made without DNA and were run through PCR at 52, 53, and 54°C (Figure 7). It was predicted that this would produce the same sort of clouds at the bottom of each of these lanes as previous gels showed. What resulted, however, were lanes with no clouds. The clouds were then considered to be non-specific binding or hairpins that formed during PCR cycling. Also, the concentration of DNA in each reaction cocktail was varied to see if that would produce results (Figure 7). DNA was varied at 2ng, 4ng, and 8ng, but nothing conclusive was drawn. However, as seen in lanes 2, 6, and 10, the wells are illuminated when 8ng of DNA were used. This could indicate that too much DNA was used because it remained in the wells and was too large to travel through the agarose gel.
In order to ensure that the primers were not mislabeled, as an explanation for the lack of results, wild type and mutant DNA were combined with differing variation of primer sets, which were run through PCR at the predicted annealing temperatures (Figure 6). From this gel, no bands were produced, and the traditional clouds appeared at the bottom of the middle lanes. Some combinations of DNA and primers were designed to not anneal together (wild type DNA with mutant primers) and the gel shows that they did not anneal and produce bands. However, it is not believed that PCR worked in these instances because the rest of the products in this gel did not produce their predicted target bands.
Coupled with a diagnostic assay, a sociological experiment was preformed to understand some of the effects Alzheimer’s disease has one daily life. It was hypothesized that the impaired events, that were used to recreate Alzheimer’s, would take a longer time than the unimpaired ones because the symptoms of Alzheimer’s negatively affects everyday activities. It was predicted that the impaired events would take a longer time to do than the unimpaired events, and the ultimate findings confirmed this prediction. Two different activities were preformed impaired and unimpaired. The first event involved some subjects typing with one arm in a brace and some without a brace. This was used to symbolize decreased motor abilities. The second event involved a subject being dropped of at an unknown location and was repeated with the same subject now knowing how to return in the most direct route. Unable to recognize the “drop-off” location was used to symbolize confusion and disorientation. When the subjects did not know where they were upon drop off, they took more time getting back to the predetermined location, compared to those who knew where they were and how they were going to get back. There was more confusion, frustration, and it took more time when the subjects experienced the recreated symptoms of Alzheimer’s (Figure 8B). The typing task test showed similar results (Figure 8A). The results supported our hypothesis that not only is physical constraint emotionally exhausting but it has a quantitative effect on everyday activities.
Future Directions
In future experimentation, several elements to the experiment would be adjusted. First, the primers would be redesigned to use a simple and traditional approach to designing primers, instead of Yaku- Bonzyck. It is possible that the Yaku-Bonczyk method is not the most effective method of primer design for this specific mutation because Primer 1 (mutant primer) and Primer 2 (wild-type primer) had a very high A-T content. This design makes it more difficult for the primers to properly anneal, since C-G bonds are stronger than A-T bonds. The Yaku-Bonzczyk method may completely stop elongation from happening due to a point mutation rather than a more specific point deletion because it could be recognized as two consecutive mismatches rather than a complimentary strand to the primer. Amplifying this single mismatch mutation may not work the best with Yaku desgined primers, and thus new primers should be designed. Their sequences would be 5’ATGAGAGCTGGAAAAAGCGTTG 3’ for Primer 1, 5’AAATGAG- AGCTGGAAAAAGCGTTT 3’ for Primer 2, and 5’AGGAATAACAGGCATGTTGTTTCC 3’ for Primer 3. Second, hot starts would be used before placing the reaction cocktails into the PCR machines in order to prevent primer dimer. Hot starts prevent the formation of non-specific binding due to the increase of temperature of the PCR cocktail above the annealing temperature. Taq polymerase is then added after the reaction cocktail has reached the denaturation temperature and then will begin the process of annealing only to the strands designated. The clouds at the bottom of most lanes most likely result from primer dimmer, and by using hot starts they should eliminate the clouds. Third, future experimentation would continue adjusting annealing temperatures of PCR products. Temperatures similar to the ones used in Figure 3 (which had bands) would be reevaluated. Finally, by continuing to readjust the concentration of DNA in the reaction cocktail between 4ng and 8ng, more target bands would be produced because PCR should work better with the correct amount of DNA.
Figure
Figure 3: Electrophoresis gel results of a PCR sample of mutant DNA with mutant primers at various annealing temperatures, 51°C, 53°C, 54°C, and 55°C. PCR had 5 stages: pre-denaturing stage for 5 minutes at 95°C, denaturing stage for 1 minute at 95°C, annealing stage for 30 seconds at the indicated temperatures as shown in the first row, extension stage for 1 minute at 72°C, and post-extension stage for 7 minutes at 72°C. Theoretically if annealing occurred, lanes 2-5 should have two bands each. The first band is the amplified segment of DNA that contains the mutation and is designed to be is 822 base pairs long. The second band is the positive control band and should be at 423 bp. Lane 5 shows the most prominent band at 822bp, inferring that 55°C could be the best annealing temperature to amplify the mutated segment of DNA compared to the other 3 annealing temperatures. Lane 3 shows a prominent band around 400 bp, which applies to the control primers. There are “clouds” at the bottoms of lanes 2-5 which most likely are small segments of nucleotides, like DNTPs and primers.