Increased Detection of p53 Mutations in Sputum Associated with Oral Cancer in Smokers vs. Non-Smokers using PCR [in Paris vs Detroit]

By: Christine Campbell, Katie Oleski, Jillian Welker, Rupal Patel

Abstract

The p53 tumor suppressor gene mutations have been linked with the development of oral squamous cell carcinomas (OSCCs) (Hsieh et al, 2001). In addition, p53 over-expression has been proposed as a reliable marker associated to oral carcinogenesis (Montebugnoli et al, 2008). In this study, we used PCR to analyze and amplify certain regions of the p53 gene (exons 5-9) from DNA obtained on saliva samples collected from buccal swabs on non-smokers and cigarette butts in both Paris and Lansing. There were 100 buccal swabs and 100 cigarette butts collected from each location. It has been discovered that the p53 mutation load (mutated p53 copies per total number of p53 copies) was associated with smoking and most of the individuals with p53 mutations observed in plasma DNA were continual smokers; in addition the p53 mutation load was higher in those who smoked for longer durations (Hagiwara, 2006). Therefore, it was hypothesized that there will be a greater number of p53 mutations present in smokers, due to an increased exposure to carcinogens found in tobacco. Furthermore, we predict that DNA containing increased p53 mutations may suggest early stages of oral cancer since research has found that in a series of carcinoma samples, 70% expressed p53 in over 5% of cells whereas in normal mucosa less than 5% of cells expressed p53 mutations (Kannan et al, 1996). In summary, we predict that p53 mutations detected in the buccal swabs collected from healthy, non-smokers could be an indicator of carcinogen exposure from tobacco smoke.

Table 1: The primers that we will use target sequences in p53 gene exons 5-9

Exon 5’-3’ Primers PCR base Pairs

5 CTTGTGCCCTGACTTTCAACTCTGTCTC 270

TGGGCAACCAGCCCTGTCGTCTCTCCA

6 CCAGGCCTCTGATTCCTCACTGATTGCTC 202

GCCACTGACAACCACCCTTAACCCCTC

7 GCCTCATCTTGGGCCTGTGTTATCTCC 173

GGCCAGTGTGCAGGGTGGCAAGTGGCTC

8 GTAGGACCTGATTTCCTTACTGCCTCTTGC 239

ATAACTGCACCCTTGGTCTCCTCCACCGC

9 CACTTTTATCACCTTTCCTTGCCTCTTTCC 144
AACTTTCCACTTGATAAGAGGTCCCAAGAC

Discussion

A genetic event that appears to be of significance in the progression of many tumor types is loss of the p53tumor suppressor gene, through either allelic deletion and/or mutation (Van Houten et al, 2000). p53 mutations are an integral part of cancer progression in almost all types of human cancer, and since mutations can be detected prior the onset of malignant lesions, they can be utilized as markers for cancer staging (Van Houten et al, 2000). Inactivation of the p53 tumor suppressor gene is a critical and early event in oral squamous cell carcinomas (OSCCs) because the p53 protein functions to induce growth arrest, DNA repair, or apoptosis in response to cellular stress (Hagiwara, 2006). In this study, it was hypothesized that there will be more p53 mutations detected after running PCR on the saliva on cigarette butts than the buccal swabs, due to smokers increased exposure to carcinogens found in tobacco. In order to investigate the presence and abundance of p53 mutations in two different metropolitan locations—Paris and Lansing, two methods of collecting DNA samples were utilized. Genomic DNA was extracted from cigarette butt paper and saliva samples using buccal swaps were taken from non-smokers.

A high incidence of p53 mutation has been demonstrated in tobacco-related cancers. In western countries, the high incidence (42.56%, 163/383) of p53 mutations in OSCCs is associated with known risk factors, specifically tobacco use (Hsieh, 2001). In addition, a study was conducted on a series of epithelium samples, one set that had carcinoma and one set that contained normal mucosa. It was found that 70 % of the samples that had carcinoma cells expressed p53 mutations in over 5% of cells, whereas in normal mucosa less than 5% of the cells expressed p53 mutations (Kannan et al, 1996). These findings strongly suggest that cigarette smoking is linked to an increased number of p53 mutations. In accordance with prior studies conducted, we predict that p53 mutations detected in the buccal swabs collected from healthy, non-smokers could be an indicator of carcinogen exposure from tobacco smoke. Furthermore, we predict that DNA containing increased p53 mutations may suggest early stages of oral cancer. Therefore, we predict that after PCR is run on the cigarette butts and buccal swabs, there will be a greater number of mutations of the p53 gene found on the cigarette butts because of the carcinogens present in the tobacco which induce mutation within the cells.

We predict it is possible to extract and amplify the particular target region of p53 gene at exon 5-9 of DNA from saliva on cigarette butts using PCR-based typing; previous research suggests that PCR-based typing of DNA offers a possible method for genetically characterizing traces of saliva on cigarette butts (Hochmeister et al, 1991). Although oral squamous cell carcinoma takes a while to develop after the first initial encounter with cigarettes, there are some genetic mutations that suggest that cancer could ensue. In previous research, the p53 gene mutation has been associated with tumor progression (Swisher et al, 1999). Furthermore preclinical studies in animal models have shown tumor regression in non-small-cell lung cancer after the injection of an adenovirus vector containing wild-type p53 complementary DNA (Ad-p53); this supports that our prediction that smokers are more likely to develop oral cancer as well as other cancers because of exposure to carcinogens found in tobacco (Swisher et al, 1999). Therefore by using PCR it will enable us to detect if there is a correlation between the presence of the p53 mutation in smokers and non-smokers, thus leading to an increased susceptibility to oral cancer.

In order to connect our findings into a broader context, we will be interviewing smokers and non-smokers present in Lansing and Paris. Prior research has suggested that cigarette smoking is an individual behavior; however it occurs in a social and cultural context (Syme and Alcalay, 1982). During the interview we will obtain information about historical, cultural, and social elements that the interviewees perceive influence attitudes towards smoking. Social influences from social norms, perceived smoking behavior, and direct pressure have been found to be significantly correlated with smoking intention and behaviors (Vries et al, 2006). Thus the interviewee’s responses collected from a series of survey questions will be analyzed using statistical software to see the correlation between societal influences, smoking tendencies, and the amount of p53 mutations detected from saliva on cigarette butts and buccal swabs.

We predict there will be error and variability present in our interviews, cigarette sampling, and buccal swab results because of limited statistical power, differences in the study protocol as well as other characteristics inherent to the studies (Simonato et al, 2006). The limited statistical power was in reference to the software that will be utilized to make the correlations between the survey results and PCR assay data. The study protocol has some error associated within it because of systematic error in the machines used. In addition, there will be some residual heterogeneity in our results which might be explained by risk factors like occupation, air pollution, indoor radon exposure and dietary habits, which affect the background risk of oral cancer creating discrepancies across the different study populations (Simonato et al, 2006). Furthermore, there will be some degree of error due to a limited sample population as well as sampling biases attributed to multiple people collecting data. However, this sampling bias was accounted for by setting a sampling rule that the cigarette and buccal swabs must be collected from the first ten people seen at a specific location. Also, statistical tests can account for some of this inherent variability.

In order to place this research in a broader context more variables need to be considered and analyzed. Additional characteristics that influence smoking habits, beliefs, attitudes and self-efficacy expectations over a longer period of time need to be studied in order to better understand the cultural component that increases a person’s susceptibility to oral cancer. In addition, this study needs to be carried out in different population in order to see a more conclusive trend resulting in differing numbers of p53 mutations present in smokers and non-smokers.