AS-PCR of CALU-3 DNA for diagnosing Phenylketonuria mutation R408W

Authors: Lindsey Foos, Emily Fox, Ben Freeman and Zach Gaudette

LB145: Cell and Molecular Biology
Tu, Th 12:40 – 2:30
Pretty Cool Researchers (PCR)
Vincent Cracolici & Katie Oleski
11/30/10

Abstract

ASPCR was used to create a rapid diagnostic procedure for PKU mutation R408W of the PAH gene that will eliminate potential false-negative results of the Guthrie assay. The allele specific primers position the C/T single nucleotide polymorphism (SNP) on the terminal 3’ nucleotide, a nucleotide complementary to both alleles in position two, and a mismatch in position three that will not anneal to either allele. We predict that amplified DNA will produce an 800bp band in electrophoresed gel only when a complementary primer-allele coupling is present (Yaku et al. 2008). Additional experimental elements were incorporated to better understand the experiences of young adults following a low-phenylalanine diet in college. Measurements of hunger, focus, mood, and energy levels were recorded at reference times throughout the trials. A survey comparing regular and phenylalanine-free pasta found that individuals preferred regular samples based on flavor, appearance, and texture (Schultz and Bremer, 1995).

Figure 1. Representation of PCR using Yaku’s technique. The left side of the picture shows that wild type primers with wild type DNA will still amplify DNA during PCR with just one nucleotide mismatch. The right side of the picture shows the forward wild type primer with the mutant DNA will not amplify DNA during PCR because of 2 nucleotide mismatches. The primers added in the PCR cocktail are also shown with the location of the intended and mutation mismatch.

Discussion

Phenylketonuria is a recessively inherited autosomal disorder. Due to a deficiency in the hepatic enzyme phenylalanine hydroxylase, infected individuals cannot properly metabolize the amino acid phenylalanine. The resulting buildup of phenylalanine can cause various degrees of damage to the brain and nervous system. The study conducted focused primarily on a specific mutation responsible for PKU, mutation R408W. This single base-pair mutation is responsible for nearly 60% of all PKU-causing mutant alleles in Russia (Ivaschenko and Baranov, 1992).

The most common tool currently used in diagnosing PKU, the Guthrie bacterial inhibition assay, is a quick and inexpensive qualitative test that produces positive results when serum phenylalanine levels exceed 180µmol/L. This creates the possibility of false-negative readings for individuals with the disease that have instantaneous serum phenylalanine levels between 120µmol/L and 180µmol/L, the established norm. It is estimated the Guthrie assay fails to detect one in twenty-five individuals affected when screened at birth (Blumenfeld et al. 1966). Consequently, this study aimed to develop a more accurate gene-based diagnostic procedure for detecting the PKU mutation R408W through PCR and agarose gel electrophoresis technologies.

It was predicted that the combination of a 3-primer polymerase chain reaction procedure with agarose gel electrophoresis analysis would be able to diagnose the R408W mutation in individuals due to previously conducted research highlighting the employment of a very similar procedure in the diagnosis of multiple haplotypes of the hematologic disease sickle-cell anemia (Ayatollahi and Haghshenas, 2004). As depicted in Figure 1, primers were designed with the mutation placed at the 3’ end of the forward sequence, along with a forced mutation residing at the third base pair from the 3’ end of the sequence in order to insure primers could only bind and extend at the proper position along the DNA sequence, providing increasingly accurate results. This method is commonly utilized while working with a single base-pair mutation (Yaku et al. 2008). The coupling of the forward mutant primer [5’ CTTGACTCTTCCTGG 3’] and the reverse primer [5’ GGTTCACCAGAGGCCAACTTA 3’] were designed to adhere to, and amplify, only a DNA strand containing the R408W mutation. On the other hand, the coupling of the forward wild-type primer [5’ CTTGACTCTTCCTGA 3’] and the reverse primer were designed to adhere to, and amplify, only a DNA strand lacking the mutation. Therefore, the two different primer combinations, when cycled, would have the ability to diagnose mutation R408W in an individual of unknown haplotype (Guldberg and Guttler, 1992).

Results yielded that lanes 3 and 5 had bands located at 762 base pairs. Thus, proving that PCR amplification of the wild-type DNA and its correlating primers worked well. Lane three held the PCR products that had an annealing temperature of 57 degrees Celsius, while lane 5 contained products that underwent annealing at 59 degrees Celsius. As it is evident, the reaction cocktail with an annealing temperature of 59 degrees Celsius produced the best band due to its increasingly concentrated, bright color and lack of smearing. Lanes 4 and 6 also resulted as expected. Since PCR products placed in each of the two wells contained wild-type DNA with the mutant primers no bands resulted, supporting the idea that amplification did not take place. Control bands could be viewed in lanes 3-6 at 480 base pairs stressing that amplification occurred between the control primers and the wild-type DNA. These results verify the initial hypothesis that an increasingly accurate gene-based diagnostic procedure can be implemented, through the incorporation of PCR and agarose gel electrophoresis analysis, in order to detect the presence of mutation R408W in diseased individuals. This analysis is thus able to serve as a more reliable auxiliary test for the detection of false-negatives initially produced by the Guthrie assay. This especially holds true in areas, such as Russia, where the R408W mutation is the most common cause of phenylketonuria (Ivaschenko and Baranov, 1992).

Results from the study add to the trend of increasingly accurate diagnostic tools being applied in the diagnosis of mutation R408W and ultimately the disease. Despite the Guthrie assay being a cheap, effective mass diagnostic test, its large percentage of false-negative readings is disturbing and testing for PKU can certainly be improved upon (Kwon and Farrell, 2000). Previously published research validates that since the advent of genetic technologies, such as PCR, more accurate diagnostics have become available for detecting phenylketonuria and specific mutation haplotypes have been isolated. The mutation R408W has already been successfully identified utilizing PCR amplification with allele-specific oligonucleotide probing (Dvorakova and Fajkusova, 1992) and chemical cleavage of mismatch, among other methods. PCR methods utilized in this study represented a relatively fast, accurate method of genetic analysis that has promise as a preventative test against the false-negatives of the Guthrie assay in areas with a largely homozygous mutation pool.

Overall, experimental design was fairly sound, however technical difficulties did arise. The most obvious complication happened to be failure to obtain a mutant DNA sample. Since the disease phenylketonuria only occurs in one in fifteen thousand individuals throughout the world, it is not one of the most common diseases exhibited in humans. As a result there are only a handful of laboratories throughout the world researching the disease and possessing a mutant DNA sample. Despite writing to several organizations and requesting the mutated sample, it was unable to be obtained. This subsequently resulted in a less comprehensive experiment being conducted. Other mechanical predicaments included beginning testing with annealing temperatures that were too low, such as 51 and 53 degrees Celsius, running the gel too quickly, and experiencing non-specific binding. Upon conducting several trials each problematic scenario was corrected through alterations made to the procedure (Roux, 1995). By gradually perfecting the procedure, the previously mentioned problems were able to be eliminated and did not result in a significant effect on the experiment.

Future research would be contingent on the success of obtaining a DNA sample affected by the R408W mutation. Upon receiving such DNA, it would be purified several times. A new reaction cocktail would be created with the appropriate primers utilized and the mutant DNA. PCR would be performed and the resulting products would be analyzed through gel electrophoresis. Additionally, future research efforts conducted throughout the world should be aimed at producing a gene-based diagnostic test with the ability to blanket multiple mutation haplotypes. This would bring the scientific field closer to an increasingly accurate diagnostic method for PKU.

In addition to designing a diagnostic test for phenylketonuria, an analysis of limitations presented by the disease while residing on a college campus was also conducted as supplemental material. It was hypothesized that, if under dietary restrictions common to individuals affected by PKU, a college student would have to routinely forego approximately 40% of cafeteria entrée choices. This prediction was a result of comparisons of the protein content in sample cafeteria dishes with guidelines of a PKU restricted diet (Schultz and Bremer, 1995). It was also predicted that while cooking for oneself in an apartment it would be more difficult to follow such a strict diet due to limited money and transportation to health food stores. Overall, it was predicted that after three days on a low protein diet students would experience a decrease in focus, energy, and mood due to an increase in hunger.

Three subjects underwent the experiment and recorded data several times throughout the day. Students reported feeling significantly hungrier. On the third day students described there cumulative hunger levels as being four points higher than on day one. However, results showed that a student’s focus, energy, and mood did not appear to be affected by the change in diet. This could be because a student had to eat less in order to have less protein in their bodies. This meant that they were always more hungry before or after a meal. With less food their body needed more energy. When the body has a shortage of energy it’ll use its stored energy to maintain the person’s normal energy levels (Melby, 2004). The data also showed meals lacking meat and many repeated meals. This shows that meal choices were limited for both dorm and apartment students. The majority of predictions were supported by the data. However, data did refute part of the hypothesis suggesting students would experience a decrease in focus, energy, and mood.

Another analysis was conducted comparing individuals overall satisfaction with low-protein foods following a PKU diet and foods normally consumed by an individual lacking the disease. It was predicted that the majority of college students would not be able to tell the difference between a low-protein, PKU approved, pasta and pasta with regular amounts of protein. First, a control was run. The same brand of pasta containing regular amounts of protein was administered under two separate titles, Pasta #1 and Pasta #2 respectively. Students were asked to rate the pasta on several factors. Results in Table 1 depict that students were unable to detect a significant difference between the two pastas. Data collected served as a supportive control helping to eliminate influences that may have otherwise skewed the data. The experiment was conducted utilizing a low-protein pasta and pasta with regular amounts of protein. As Table 1 depicts, students could tell the difference between the two pasta’s in terms of visual appeal, flavor scale, and overall satisfaction. Pasta 1, which had regular protein levels, ranked 2.5 to 4 points above the low protein pasta. The difference in visual appeal could be due to the fact that the low protein pasta was somewhat translucent and white in color, while students may have found the flavor lacking since the pasta was protein deficient. The only variable tested that was not significantly different between the two pasta types was texture since there was only a difference of 0.0333. This was most likely due to the pastas being created through the same process with similar machines being implemented. By and large, the data contradicts previous predictions.

Eventually, changes should be made due to similar research that allows college students with restricted diets, such as those suffering from phenylketonuria, to obtain meals within their dietary boundaries on an increasingly easier basis.

Results

The technique described by Yaku was used while designing the primers used in PCR. This was due to the fact that R408W is only 1 base pair mutation. Figure 1 shows that one nucleotide mismatch in the primer can result in DNA amplification because a small bump can form in the DNA and elongation can still occur. This can happen either due to an intended nucleotide mismatch or the mutation nucleotide mismatch. If both occur making a 2 nucleotide mismatch, approximately 13 nucleotides apart, then DNA cannot replicate during PCR because a bump too big will form. This means that the primer can’t elongate down the DNA strand (Yaku et al. 2008). The primers added to the cocktail to be used in PCR are also shown along with the two mismatch locations on the sequence. Five primers were added to the cocktail to get the results.

The resulting cocktails from this technique were run in 1% agarose gel using electrophoresis (Figure2). A 1 kb ladder was run in the first lane and the base pair lengths are labeled. No bands were detectable in lane 2 due to the fact that it was a negative control cocktail not containing DNA. Lanes 3 and 5 contain bands at the 762 bp position to show amplification of a segment of DNA 762 bp long occured. Lanes 4 and 6 don’t contain these bands showing that no amplification was detectable at the 762 bp length. Control bands were seen at the 480 bp position in lanes 3-6 showing that amplification occurred between the wild type DNA and control primers. Some unknown bands were also visible below the control bands at approximately 100 bp. It was also noted that the bands were cleaner and brighter at a 59°C annealing temperature than at 57°C.

Table 1 shows the control and experimental taste tests. The control taste test pastas were the same, meaning they were from the same batch. Some participants even noticed that they were the same. The average of differences between pasta 1 and pasta 2 was 0.26 points. The average standard error was 0.81. Since the standard error is much higher than the difference between the averages of the ratings this means that difference is insignificant. The experimental taste test pastas were different. Pasta 1 was the normal pasta used before, and pasta 2 was the low-protein, PKU diet pasta. Table 1 shows that there is a huge different between the scorings of pasta 1 and pasta 2. Pasta 2 was scored much lower in every category except for texture. Pasta 2 was an average of 2.42 points lower in score than pasta 1. The average for standard error was 0.18. Since the difference is higher than the standard error this means that there is a significant difference between the ratings of pasta 1 and pasta 2.

In the experiment done by 3 test subjects a PKU diet was followed for 3 days. The subject measured 4 different categories (1-low to 10-high) at 3 hour intervals from 10 am – 10 pm. The scores were added up per day and averaged with other subject’s scores. This allowed comparing between each day and category. Table 2 shows that focus, energy, and mood didn’t change more than 1.3 points. Hunger rose by 4.3 points which is a significant change over the 3 days compared to the other 3 categories.

Future Directions

While results were obtained, portions of this experiment could be refined. At annealing temperatures below 55°C, PCR amplified fragments that were significantly shorter than the predicted products. However, these short bands did appear in a predictable pattern. It was hypothesized that the allele specific primers possibly annealed to a nucleotide sequence, very similar to the target sequence, located ~500bp downstream. Future research would focus on temperatures above 57ºC and utilize the NCBI PrimerBlast^® program to alleviate this issue.

Multiple electrophoresed gels also contained bent bands, indicating that the voltage used to run the gel was too high. Utilizing lithium bromide in 1% agarose, it was eventually determined that 135V represented the ceiling of acceptable voltage. Future research would focus of electrophoresis voltages less that 100V in an attempt to produce crisper bands.

During the pasta preference experiment, salt was added from a shaker to the pot of boiling water and noodles during cooking. The saltshaker did not provide an accurate measurement of how much salt was added to the two pastas, and may have proved a factor in the overall taste of the pasta. Future trials would either add a predetermined amount of salt or no salt.