Development of Assay for E60X CFTR Mutation in IB3 Cell Lines Using PCR and Statistical Analysis of Medical Compliance

 

 

 

 

 

 

 

 

 

 

 

 

 

 

By: Natasha Bhaskaran, Andrew Brown, and Steve Ragatzki

 

 

 

 

 

 

 

 

 

LB145: Cell and Molecular Biology

Tuesdays 7 PM

The Fantastic “Four”

Valerie Rygiel and Eric Gurzell

11/30/09

http://www.msu.edu/~bhaskar3

Abstract

            Many mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) exist, so characterizing a diagnosis for a particular mutation is valuable in terms of scientific research and health.  Mutations of interest include ΔF508 and E60X, a class I mutation caused by substitution of a thymine for a guanine at base pair 29086 on exon 3, leading to formation of a TAG stop codon at amino acid number 60 (Cheadle et al , 1993).  To assay both mutations, polymerase chain reaction (PCR) was conducted on IB3 cells from CF patients.  Using the Yaku (Yaku et al , 2008) primer design method, forward and reverse primers were designed to anneal 428 base pairs apart to diagnose E60X. Wild-type E60X reverse primers were designed to bind with guanine at base pair 29086, while mutant primer reverse binds with a thymine. Presence of a band at 428 base pairs for E60X wild-type primers  indicated  lack of E60X mutation.  DF508 control primers annealed at 35°C and ensured accurate tests were consistently preformed. It was determined experimentally that this assay works best for temperatures 40-42°C with 15mmol-25mmol MgCl2 in PCR for the E60X primers to produce a DNA band in gel electrophoresis. CF requires numerous treatments, so practicing medical adherence, or complying with physician advice, is important. Patients with chronic illness have been found to be more medically adherent than those without (DiMatteo, 2002). Polling of MSU students and community members in East Lansing showed that there is only a statistically significant difference in medical adherence with regard to antibiotic cycle completion.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1KB Ladder (5μl)    E60X wt     E60X mut   ∆F508 water. ∆F508 wt  ∆F508 mut.  Ladder (3μl) 

Volume DNA:            10μl            10μl             neg, 10μl        10μl          10μl         

 

1,636

1,018

 

 

~583

506

~400

 

 

 

 
 

1,636

1,018

 

506

428

 

 

 

 
 

 

Figure 5: PCR amplification of DNA segment from IB3 cells to test for E60X and ∆F508.  Thermocycling conditions involved an initial three minute denaturation at 94°C, followed by 40 cycles of 30 s at 94°C denaturation, 30 s at 42°C (for E60X) and 35°C (for ∆F508) annealing, 30 s at 72°C extension, and a final extension of seven minutes at 72°C. The targeted E60X DNA was 383 base pairs in length and the targeted ∆F508 DNA was 583 base pairs in length.  The band at 383 base pairs in lane 2 signifies that the E60X mutation is not present because the E60X forward primer and E60X wild type reverse primer bound to the wild type IB3 DNA and produced the expected band size.  There are also bands 583 base pairs apart in lane 6, because the ∆F508 mutant primers bound successfully at 583 base pairs apart and created a band.  However, at the lower annealing temperatures for the ∆F508 PCR, there is smearing in the band because of nonspecific binding.  In lane 4, a water negative control was used and contained all of the same PCR ingredients as the ∆F508 primers except for the DNA.  Different amounts of ladder were used in lanes one and eight.  Each amount produced bands of similar quality.

 

Discussion

Experiment Overview

Cystic fibrosis is the most common autosomal recessive genetic disorder among Caucasians (Rosenstein, 1998).  It is caused by a mutation of the CFTR gene, encompassing approximately 180,000 base pairs on chromosome 7 (Rowe et al, 2005).  The CFTR gene regulates chloride ion travel across the membranes of epithelial cells, and disruptions in chloride ion travel cause mucus buildup that leads to malfunction of organs such as the lungs, liver, pancreas, and intestines (Welsh and Smith, 1995).  There are many different mutations of the CFTR protein, with the DF508 mutation being the most common.  Our mutation, E60X, involves a substitution of a thymine for a guanine at base pair 29086 (Cheadle et al, 1993).  The E60X mutation has been described as a class I mutation (Dugueperoux and Braekeleer, 2004).  The purpose of this experiment was to test for the presence of the E60X and DF508 mutations in samples of DNA obtained from CF patients using PCR and gel electrophoreses techniques.  To test for the E60X mutation, we designed primers for use in PCR to amplify the mutation region in the DNA, which we then used to analyze with gel electrophoreses.  Using these techniques, we hypothesized that with the Yaku primers binding to the specific sequence in PCR, that gel electrophoresis would allow us to determine whether the patient was homozygous for either mutation, heterozygous for either mutation, or lacked either the E60X or DF508 mutations.  Tests confirmed that the IB3 cells were homozygous for wild-type E60X and homozygous for ∆F508 mutation.   

 

Interpreting PCR Results

The gel produced a DNA band of 428 base pairs from IB3 DNA that had been amplified using just the designed E60X forward primer 5’GATCAAGGTATAAGGGAAAAATG3’  and E60X reverse wild-type primer 5’GATTTTTCTTTGAAGCCAGTTC3’. This confirmed that the cells do not have the E60X mutation.   If the gel had produced a DNA band at 428 base pairs using the mutant E60X primers, this would have provided evidence that the cells contained the E60X mutation.  The IB3 cells would have been determined to be heterozygous for E60X if both the mutant reverse primer and wild type control reverse primer, in conjunction with the forward primer, produced bands at 428 base pairs.  Because no DNA band appeared with the mutant primer, the IB3 cells are homozygous for not having E60X mutation.  The evidence was contingent on proper primer function, annealing, and amplification in PCR.  Multiple tests were run to ensure that primer function was indeed working correctly.

 

ΔF508 Control

To further ensure the success of the experimental design, PCR was also run with the goal of testing for the ΔF508 mutation.  The gel produced a band of 583 base pairs in the sample of IB3 DNA that was amplified using the designed ΔF508 reverse primer 5’CATCAAAGAATTGCAGTCACTA 3’  and ΔF508 forward mutant primer 5’CACCATTAAAGAAAATATCATTGG3’.  This confirmed that the IB3 cells have the ΔF508 mutation.  A wild type forward primer 5’CACCATTAAAGAAAAATATCATCTT3’ that is also 583 base pairs away from the same forward primer was designed.  If the forward wild-type primer and reverse primer produced a DNA band at 583 base pairs in a gel, this would have provided evidence for one of two circumstances: the IB3 cells would be either heterozygous for the ΔF508 mutation or would not have the mutation.  No DNA band was produced with the wild-type primers, so the cells were homozygous for the ∆F508 mutation.  Once again, the evidence is contingent on proper primer function, annealing, and amplification in PCR.  By testing for both the E60X and ΔF508 mutations, we can better ensure that these factors are working correctly.

 

Optimizing Results

            By manipulating different variables involved in PCR, different quality bands resulted when the gels were run.  We hypothesized that with optimal combination of temperatures, PCR ingredients and properly designed Yaku primers, that we could reliably detect the E60X mutation with a DNA band of 428 base pairs that reflects the distance between the forward and reverse primers.  Although the focus of our research was the E60X mutation, testing for the ΔF508 mutation as well allowed us to ensure that our optimal PCR conditions would work in more than one instance.  We believed that a specific annealing temperature, as well as concentrations of primers, dNTPs, LB buffer, Taq polymerase, and DNA could be found that would consistently and clearly indicate the presence or absence of the E60X mutation when run through PCR and gel electrophoresis. While annealing temperatures of 40°C to 42°C were found to produce appropriate DNA bands, magnesium chloride made the DNA bands brighter when added to the PCR cocktail.  Magnesium chloride helps increase the reaction time and will optimize the yield and specificity making the DNA band brighter (McPherson et al, 2001).  We believe that we have optimized the tests for the E60X mutation to a level of enough consistency to have significant credibility.

 

Medical Adherence

            The medical adherence interview was designed to differentiate medical adherence to antibiotics between students and community members.  Community members are generally older than students and have most likely had more experiences with antibiotics and medical adherence on average.  Studies of asthma have shown lower levels of adherence younger people (Fiese, 2005).  Additionally, some antibiotics require those taking them to avoid alcohol.  Since college educated people on average drink more than those who do not have a college education, such behavior might be a barrier to antibiotic adherence (Wechsler et al, 1998).  Therefore, we hypothesized that there would be a significant difference in medical adherence to antibiotics, as analyzed by a t-test and t-value data, with the community members on average proving to be more adherent to antibiotic treatments than students.

            The results show a statistically significant difference between community members and students involving the likelihood to complete an antibiotic cycle (t=3.49).  This supports the hypothesis that community members are more medically adhered.  Based on the categorized free response question, community members are also more likely to not take antibiotics unless it is a bacterial infection.  Students more often cite that do not like taking medicines as a reason for not preferring to take antibiotics.  However, for both the community and students, their main reason for taking antibiotics was so that they can get better faster and more efficiently.  Community members cited this efficiency as a reason for preferring antibiotics more often than students.  The data from the interviews was also analyzed for male versus female, community male versus community female, and student male versus student female.  While some trends existed in the data, for example, females generally showed greater adherence than males, these differences were not statistically significant.  By learning about the difference between the populations, the scientific community will be able to better understand how to make people more medically compliant by better knowing who to educate about medical adherence. 

Future Directions

            We originally had difficulty producing a bright DNA band, so the amount of cycles was increased from 35 to 40 in order to amplify the DNA exponentially. The brightness of the DNA band also increased by adding magnesium chloride to the PCR cocktail. Because magnesium chloride has been known to optimize the yield, a brighter band was observed (McPherson, 2001).  If more time was allotted for the experiment, the ∆F508 mutation assay would be perfected and the optimizing annealing temperature range would be found.  Also, DNA from an actual patient with the E60X mutation could be tracked down and the same experiment could be done again to ensure that this assay works.  Restriction enzymes could be used to split the expected 428 base pair DNA band into bands of 300bp and 128bp.  This would provide further confirmation that the primers were annealing to the correct sequence of DNA. 

            If more time were available for research, the entire assay could be redesigned.  Instead of testing for E60X and ∆F508 individually, a more streamlined assay could be designed.  This assay would have E60X and ∆F508 primers in the same cocktail and would produce two DNA bands in a gel.  The length of the current primers prevents us from doing this, because of the annealing temperature differences that would result in non-specific binding.  The ∆F508 primers could be redesigned to amplify a 1000bp segment of DNA and also anneal at a 40°C.  This would allow for simultaneous determination of E60X and ∆F508. An issue that would have to be considered when designing this assay would be the possibility of primer dimer among the four primers in the cocktail. Primers must be designed so that they will not anneal to each other. The possibility of E60X primers working with ∆F508 primers to amplify a segment of DNA much larger than expected would also be present, so extension times would have to be short enough to prevent the entire wrong segment from completely copying. If these issues could be resolved, a better, more informative assay could be used for diagnosis of different mutations of CF in the medical field.